SGPL1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11395-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SGPL1 Reagents
CRO Services
Product recommended

All SGPL1 Reagents
SGPL1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1707 bp
Description
Full length Clone DNA of Human sphingosine-1-phosphate lyase 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SGPL1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
S1PL cDNA ORF Clone, Human;SPL cDNA ORF Clone, Human
SGPL1 Background Information
Full Name
sphingosine-1-phosphate lyase 1

SGPL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SGPL1 cDNA ORF Clone in Cloning Vector, Mouse MG58333-U
SGPL1 cDNA ORF Clone, Mouse, untagged MG58333-UT
SGPL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58333-ACG
SGPL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58333-ACGLN
SGPL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58333-ANG
SGPL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58333-ACR
SGPL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58333-ANR
SGPL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58333-CF
SGPL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58333-NF
SGPL1 cDNA ORF Clone, Mouse, C-His tag MG58333-CH
SGPL1 cDNA ORF Clone, Mouse, N-His tag MG58333-NH
SGPL1 cDNA ORF Clone, Mouse, C-HA tag MG58333-CY
SGPL1 cDNA ORF Clone, Mouse, N-HA tag MG58333-NY
SGPL1 cDNA ORF Clone, Mouse, C-Myc tag MG58333-CM
SGPL1 cDNA ORF Clone, Mouse, N-Myc tag MG58333-NM

SGPL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SGPL1 cDNA ORF Clone in Cloning Vector, Human HG11395-M
SGPL1 cDNA ORF Clone, Human, untagged HG11395-UT
SGPL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11395-ACGLN
SGPL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11395-ACG
SGPL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11395-ANG
SGPL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11395-ACR
SGPL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11395-ANR
SGPL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11395-CF
SGPL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11395-NF
SGPL1 cDNA ORF Clone, Human, C-His tag HG11395-CH
SGPL1 cDNA ORF Clone, Human, N-His tag HG11395-NH
SGPL1 cDNA ORF Clone, Human, C-HA tag HG11395-CY
SGPL1 cDNA ORF Clone, Human, N-HA tag HG11395-NY
SGPL1 cDNA ORF Clone, Human, N-Myc tag HG11395-NM
SGPL1 qPCR Primer Pairs, Human HP101272
info info
添加购物车成功! 添加购物车失败!