SGCE cDNA ORF Clone, Human, N-His tag

Cat: HG14899-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SGCE Reagents
CRO Services
Product recommended

All SGCE Reagents
SGCE cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1314 bp
Description
Full length Clone DNA of Human sarcoglycan, epsilon with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SGCE cDNA ORF Clone, Human, N-His tag Alternative Names
DYT11 cDNA ORF Clone, Human;ESG cDNA ORF Clone, Human
SGCE Background Information
Full Name
sarcoglycan, epsilon

SGCE cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SGCE cDNA ORF Clone in Cloning Vector, Mouse MG53572-U
SGCE cDNA ORF Clone, Mouse, untagged MG53572-UT
SGCE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53572-ACG
SGCE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53572-ACGLN
SGCE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53572-ACR
SGCE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53572-CF
SGCE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53572-NF
SGCE cDNA ORF Clone, Mouse, C-His tag MG53572-CH
SGCE cDNA ORF Clone, Mouse, N-His tag MG53572-NH
SGCE cDNA ORF Clone, Mouse, C-HA tag MG53572-CY
SGCE cDNA ORF Clone, Mouse, N-HA tag MG53572-NY
SGCE cDNA ORF Clone, Mouse, C-Myc tag MG53572-CM
SGCE cDNA ORF Clone, Mouse, N-Myc tag MG53572-NM

SGCE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SGCE cDNA ORF Clone in Cloning Vector, Human HG14899-G
SGCE cDNA ORF Clone, Human, untagged HG14899-UT
SGCE cDNA ORF Clone, Human, C-GFPSpark® tag HG14899-ACG
SGCE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14899-ACGLN
SGCE cDNA ORF Clone, Human, N-GFPSpark® tag HG14899-ANG
SGCE cDNA ORF Clone, Human, C-OFPSpark® tag HG14899-ACR
SGCE cDNA ORF Clone, Human, N-OFPSpark® tag HG14899-ANR
SGCE cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14899-CF
SGCE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14899-NF
SGCE cDNA ORF Clone, Human, C-His tag HG14899-CH
SGCE cDNA ORF Clone, Human, C-HA tag HG14899-CY
SGCE cDNA ORF Clone, Human, N-HA tag HG14899-NY
SGCE cDNA ORF Clone, Human, C-Myc tag HG14899-CM
SGCE cDNA ORF Clone, Human, N-Myc tag HG14899-NM
SGCE qPCR Primer Pairs, Human HP103528
info info
添加购物车成功! 添加购物车失败!