Quick Order

Text Size:AAA

Human SETD7/SET7/9 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human SETD7 cDNA Clone Product Information
NCBI RefSeq:NM_030648.2
RefSeq ORF Size:1101bp
cDNA Description:Full length Clone DNA of Homo sapiens SET domain containing (lysine methyltransferase) 7 with C terminal HA tag.
Gene Synonym:KMT7, SET7, SET9, SET7/9, FLJ21193, KIAA1717, SETD7
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Histone-lysine N-methyltransferase SETD7, also known as SET domain containing (lysine methyltransferase) 7, SET7/9, Histone H3-K4 methyltransferase SETD7, H3-K4-HMTase SETD7, and SETD7, is a member of the histone-lysine methyltransferase family and SET7 subfamily. SETD7 is widely expressed and expressed in pancreatic islets. SETD7 contains three MORN repeats and one SET domain. SETD7 plays a central role in the transcriptional activation of genes such as collagenase or insulin. As a protein lysine methyltransferase (PKMT), SETD7 also has methyltransferase activity toward non-histone proteins such as p53/TP53, TAF10, and possibly TAF7 by recognizing and binding in substrate proteins. The mono-methyltransferase activity of SETD7 is achieved by disrupting the formation at near-attack conformations for the dimethylation reaction. SETD7 is also a novel coactivator of NF-kappaB and plays a role in inflammation and diabetes.

References
  • Wang, H. et al., 2002, Mol Cell 8 (6): 1207-17. 
  • Jacobs, SA. et al., 2002, Nat. Struct. Biol. 9 (11): 833-8. 
  • Xiao B, et al., 2003, Nature. 421 (6923): 652-6.
  • Martens, JH. et al., 2003, Mol. Cell. Biol. 23: 1808-1816.
  • Couture, JF. et al., 2006, Nat Struct Mol Biol  13 (2): 140-6.
  • Size / Price
    Catalog: HG11209-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"