SerpinI2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11008-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SerpinI2 Reagents
CRO Services
Product recommended

All SerpinI2 Reagents
SerpinI2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1218 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human serpin peptidase inhibitor, clade I (pancpin), member 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.26kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SerpinI2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SerpinI2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
SerpinI2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
MEPI cDNA ORF Clone, Human;PANCPIN cDNA ORF Clone, Human;PI14 cDNA ORF Clone, Human;TSA2004 cDNA ORF Clone, Human
SerpinI2 Background Information

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified.
Serpin-I2, also known as myoepithelium-derived serine protease inhibitor, Pancreas-specific protein TSA2004, Peptidase inhibitor 14, PI14, SERPINI2 and MEPI, is a secreted protein which belongs to the serpin family. It is expressed in pancreas and adipose tissues. SERPINI2 deficiency directly results in the acinar cell apoptosis and malabsorption.

Full Name
serpin peptidase inhibitor, clade I (pancpin), member 2
References
  • Riewald M. et al., 1995, J. Biol. Chem. 270: 26754-7.
  • Forsyth, S. et al., 2003, Genomics 81: 336-45. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-97.
  • Loftus,S.K. et al., 2005, PLoS Genet. 1 (3):e38.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Przygodzka, P. et al., 2010, BMC Cell Biol. 11: 30. 
  • info info
    添加购物车成功! 添加购物车失败!