Quick Order

Text Size:AAA

Human Neuroserpin/SerpinI1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human SERPINI1 cDNA Clone Product Information
NCBI RefSeq:NM_001122752.1
RefSeq ORF Size:1233bp
cDNA Description:Full length Clone DNA of Homo sapiens serpin peptidase inhibitor, clade I (neuroserpin), member 1 with C terminal Flag tag.
Gene Synonym:PI12, neuroserpin, DKFZp781N13156
Species:Human
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Neuroserpin, also known as Protease inhibitor 12 and SERPINI1, is a secreted protein which belongs to the serpin family. Neuroserpin is a serine protease inhibitor that inhibits plasminogen activators and plasmin but not thrombin. Serine protease inhibitors of the serpin superfamily are involved in many cellular processes. Neuroserpin was first identified as a protein secreted from the axons of dorsal root ganglion neurons. Neuroserpin is predominantly expressed in the brain, and is expressed in the late stages of neurogenesis during the process of synapse formation. Overexpression of neuroserpin in an anterior pituitary corticotroph cell line results in the extension of neurite-like processes, suggesting that neuroserpin may play a role in cell communication, cell adhesion, and/or cell migration. Neuroserpin may be involved in the formation or reorganization of synaptic connections, as well as synaptic plasticity in the adult nervous system. Neuroserpin may also protect neurons from cell damage by tissue-type plasminogen activator. Defects of neuroserpin are the cause of familial encephalopathy with neuroserpin inclusion bodies (FEN1B).

References
  • Schrimpf SP. et al., 1997, Genomics. 40 (1): 55-62.
  • Hill RM. et al., 2002, Ann N Y Acad Sci. 971: 406-15.
  • Yepes M. et al., 2004, Thromb. Haemost. 91 (3): 457-64.
  • Galliciotti G. et al., 2006, Front Biosci. 11: 33-45.
  • Size / Price
    Catalog: HG11107-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"