SERINC1 cDNA ORF Clone, Human, C-His tag

Cat: HG14071-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SERINC1 Reagents
CRO Services
Product recommended

All SERINC1 Reagents
SERINC1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1362 bp
Description
Full length Clone DNA of Human serine incorporator 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SERINC1 cDNA ORF Clone, Human, C-His tag Alternative Names
TDE1L cDNA ORF Clone, Human;TDE2 cDNA ORF Clone, Human;TMS-2 cDNA ORF Clone, Human;TMS2 cDNA ORF Clone, Human
SERINC1 Background Information
Full Name
serine incorporator 1

SERINC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SERINC1 cDNA ORF Clone in Cloning Vector, Mouse MG51215-U
SERINC1 cDNA ORF Clone, Mouse, untagged MG51215-UT
SERINC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51215-ACGLN
SERINC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51215-ACG
SERINC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51215-ACR
SERINC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51215-CF
SERINC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51215-NF
SERINC1 cDNA ORF Clone, Mouse, C-His tag MG51215-CH
SERINC1 cDNA ORF Clone, Mouse, N-His tag MG51215-NH
SERINC1 cDNA ORF Clone, Mouse, C-HA tag MG51215-CY
SERINC1 cDNA ORF Clone, Mouse, N-HA tag MG51215-NY
SERINC1 cDNA ORF Clone, Mouse, C-Myc tag MG51215-CM
SERINC1 cDNA ORF Clone, Mouse, N-Myc tag MG51215-NM
SERINC1 qPCR Primer Pairs, Mouse MP201099

SERINC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SERINC1 cDNA ORF Clone in Cloning Vector, Human HG14071-G
SERINC1 cDNA ORF Clone, Human, untagged HG14071-UT
SERINC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14071-ACG
SERINC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14071-ACGLN
SERINC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14071-ACR
SERINC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14071-CF
SERINC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14071-NF
SERINC1 cDNA ORF Clone, Human, N-His tag HG14071-NH
SERINC1 cDNA ORF Clone, Human, C-HA tag HG14071-CY
SERINC1 cDNA ORF Clone, Human, N-HA tag HG14071-NY
SERINC1 cDNA ORF Clone, Human, C-Myc tag HG14071-CM
SERINC1 cDNA ORF Clone, Human, N-Myc tag HG14071-NM
SERINC1 qPCR Primer Pairs, Human HP102726
info info
添加购物车成功! 添加购物车失败!