After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SEMA6A Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SEMA6A cDNA Clone Product Information
NCBI RefSeq:NM_020796.3
RefSeq ORF Size:3093bp
cDNA Description:Full length Clone DNA of Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A.
Gene Synonym:VIA, SEMA, HT018, SEMAQ, SEMA6A1, KIAA1368, SEMA6A
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SEMA6A
Restriction Site:KpnI + NotI (6.1kb + 3.09kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SEMA6A Gene Plasmid Map
Human SEMA6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
References
  • Klostermann A., et al., 2000, J. Biol. Chem. 275:39647-53.
  • Nagase T., et al., 2000, DNA Res. 7:65-73.
  • Schmutz J., et al., 2004, Nature 431:268-74.
  • Neufeld, G. et al., 2005, Front Biosci. 10 : 751-60.
  • Fiore,R. et al., 2005, Mol Cell Biol. 25 (6):2310-9.
  • Size / Price
    Catalog: HG11189-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human SEMA6A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"