Quick Order

Human Semaphorin 5A/SEMA5A Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SEMA5A cDNA Clone Product Information
NCBI RefSeq:NM_003966.2
RefSeq ORF Size:3225bp
cDNA Description:Full length Clone DNA of Homo sapiens sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A.
Gene Synonym:semF, SEMAF, FLJ12815
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Semaphorins are secreted, transmembrane, and GPI-linked proteins, defined by cysteine-rich semaphorin protein domains, that have important roles in a variety of tissues. Humans have 20 semaphorins, Drosophila has five, and two are known from DNA viruses. Semaphorins are found in nematodes and crustaceans but not in non-animals. They are grouped into eight classes on the basis of phylogenetic tree analyses and the presence of additional protein motifs. Semaphorins have been implicated in diverse developmental processes such as axon guidance during nervous system development and regulation of cell migration. Semaphorin-5A, also known as Semaphorin-F, Sema F, SEMA5A and SEMAF, is a single-pass type I membrane protein which belongs to the semaphorin family. Semaphorin5A / SEMA5A contains one PSI domain, one Sema domain and seven TSP type-1 domains. It may act as positive axonal guidance cues. Semaphorin5A / SEMA5A is an axon regulator molecule and plays major roles during neuronal and vascular development. It plays an essential role in embryonic development. Semaphorin5A / SEMA5A induces endothelial cell migration from pre-existing vessels. It also plays a role in autism, reducing the ability of neurons to form connections with other neurons in certain brain regions.

References
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci.  99 (26): 16899-903.
  • Neufeld G. et al., 2005, Front Biosci. 10: 751-60.
  • Fiore R. et al., 2005, Mol Cell Biol. 25 (6): 2310-9.
  • Yazdani U. et al., 2006, Genome Biol. 7 (3): 211.
  • Sadanandam A. et al., 2010, Microvasc Res. 79 (1): 1-9.
  • Size / Price
    Catalog: HG11300-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"