Text Size:AAA

Human Semaphorin 5A/SEMA5A Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human SEMA5A cDNA Clone Product Information
    NCBI RefSeq:NM_003966.2
    RefSeq ORF Size:3225bp
    cDNA Description:Full length Clone DNA of Homo sapiens sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A with N terminal Myc tag.
    Gene Synonym:semF, SEMAF, FLJ12815
    Species:Human
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SEMA5A qPCR primers for gene expression analysis, HP101177 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Semaphorins are secreted, transmembrane, and GPI-linked proteins, defined by cysteine-rich semaphorin protein domains, that have important roles in a variety of tissues. Humans have 20 semaphorins, Drosophila has five, and two are known from DNA viruses. Semaphorins are found in nematodes and crustaceans but not in non-animals. They are grouped into eight classes on the basis of phylogenetic tree analyses and the presence of additional protein motifs. Semaphorins have been implicated in diverse developmental processes such as axon guidance during nervous system development and regulation of cell migration. Semaphorin-5A, also known as Semaphorin-F, Sema F, SEMA5A and SEMAF, is a single-pass type I membrane protein which belongs to the semaphorin family. Semaphorin5A / SEMA5A contains one PSI domain, one Sema domain and seven TSP type-1 domains. It may act as positive axonal guidance cues. Semaphorin5A / SEMA5A is an axon regulator molecule and plays major roles during neuronal and vascular development. It plays an essential role in embryonic development. Semaphorin5A / SEMA5A induces endothelial cell migration from pre-existing vessels. It also plays a role in autism, reducing the ability of neurons to form connections with other neurons in certain brain regions.

    References
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci.  99 (26): 16899-903.
  • Neufeld G. et al., 2005, Front Biosci. 10: 751-60.
  • Fiore R. et al., 2005, Mol Cell Biol. 25 (6): 2310-9.
  • Yazdani U. et al., 2006, Genome Biol. 7 (3): 211.
  • Sadanandam A. et al., 2010, Microvasc Res. 79 (1): 1-9.
  • Size / Price
    Catalog: HG11300-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"