After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Semaphorin 5A/SEMA5A Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human SEMA5A cDNA Clone Product Information
NCBI RefSeq:NM_003966.2
RefSeq ORF Size:3225bp
cDNA Description:Full length Clone DNA of Homo sapiens sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A with N terminal HA tag.
Gene Synonym:semF, SEMAF, FLJ12815
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Semaphorins are secreted, transmembrane, and GPI-linked proteins, defined by cysteine-rich semaphorin protein domains, that have important roles in a variety of tissues. Humans have 20 semaphorins, Drosophila has five, and two are known from DNA viruses. Semaphorins are found in nematodes and crustaceans but not in non-animals. They are grouped into eight classes on the basis of phylogenetic tree analyses and the presence of additional protein motifs. Semaphorins have been implicated in diverse developmental processes such as axon guidance during nervous system development and regulation of cell migration. Semaphorin-5A, also known as Semaphorin-F, Sema F, SEMA5A and SEMAF, is a single-pass type I membrane protein which belongs to the semaphorin family. Semaphorin5A / SEMA5A contains one PSI domain, one Sema domain and seven TSP type-1 domains. It may act as positive axonal guidance cues. Semaphorin5A / SEMA5A is an axon regulator molecule and plays major roles during neuronal and vascular development. It plays an essential role in embryonic development. Semaphorin5A / SEMA5A induces endothelial cell migration from pre-existing vessels. It also plays a role in autism, reducing the ability of neurons to form connections with other neurons in certain brain regions.

References
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci.  99 (26): 16899-903.
  • Neufeld G. et al., 2005, Front Biosci. 10: 751-60.
  • Fiore R. et al., 2005, Mol Cell Biol. 25 (6): 2310-9.
  • Yazdani U. et al., 2006, Genome Biol. 7 (3): 211.
  • Sadanandam A. et al., 2010, Microvasc Res. 79 (1): 1-9.
  • Size / Price
    Catalog: HG11300-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"