PSGL-1 / CD162 cDNA ORF Clone, Human, C-His tag

Cat: HG10490-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PSGL-1 / CD162 Reagents
CRO Services
Product recommended

All PSGL-1 / CD162 Reagents
PSGL-1 / CD162 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1254 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human selectin P ligand with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI(6kb+1.25kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
PSGL-1 / CD162 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PSGL-1 / CD162 cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
PSGL-1 / CD162 cDNA ORF Clone, Human, C-His tag Alternative Names
CD162 cDNA ORF Clone, Human;CLA cDNA ORF Clone, Human;PSGL-1 cDNA ORF Clone, Human;PSGL1 cDNA ORF Clone, Human
PSGL-1 / CD162 Background Information

P-selectin glycoprotein ligand-1 (PSGL-1), also known as SELPLG or CD162, is the high affinitycounter-receptor for P-selectin on expressed on activated endothelial cells and platelets. PSGL-1 is a mucin-type glycoprotein, expressed on leukocytes and platelets as a homodimer of two disulfide-linked subunits of ~120 kD. As cell adhesion molecules, multiple studies have shown that PSGL-1/ P-selectin interaction is required for the normal recruitment of leukocytes during inflammatory reactions, and also participates in hemostatic responses. PSGL-1 protein requires two distinct posttranslational modifications for the Ca2+-dependent recognition by the lectin domain of P-selectin, that is tyrosine sulfation and specific O-linked glycosylation (sialic acid and fucose). PSGL-1 can also bind to other two members of the selectin family, E-selectin (endothelial) and L-selectin (leukocyte), but binds best to P-selectin.

Full Name
selectin P ligand
References
  • 1. Sako, D. et al., 1993, Cell. 75: 1179-1186.
  • 2. Wilkins, P. P. et al., 1995, J. Biol. Chem. 270: 22677-22680.
  • 3. Frenette, P. S. et al., 2000, J. Exp. Med. 191: 1413-1422.
  • 4. Vandendries, E.R .et al., 2004, Thromb. Haemost. 92: 459-466..
  • 5. Pouyani, T. et al., 1995, Cell. 83: 333-343.
  • PSGL-1 / CD162 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PSGL-1 / CD162 cDNA ORF Clone in Cloning Vector, Mouse MG50770-G
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, untagged MG50770-UT
    PSGL-1 / CD162 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50770-ACGLN
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50770-ACG
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50770-ACR
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50770-CF
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50770-NF
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, C-His tag MG50770-CH
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, N-His tag MG50770-NH
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, C-HA tag MG50770-CY
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, N-HA tag MG50770-NY
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, C-Myc tag MG50770-CM
    PSGL-1 / CD162 cDNA ORF Clone, Mouse, N-Myc tag MG50770-NM
    PSGL-1 / CD162 qPCR Primer Pairs, Mouse MP200744

    PSGL-1 / CD162 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PSGL-1 / CD162 cDNA ORF Clone in Cloning Vector, Human HG10490-M
    PSGL-1 / CD162 cDNA ORF Clone, Human, untagged HG10490-UT
    PSGL-1 / CD162 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10490-ACGLN
    PSGL-1 / CD162 cDNA ORF Clone, Human, C-GFPSpark® tag HG10490-ACG
    PSGL-1 / CD162 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13863-ACGLN
    PSGL-1 / CD162 cDNA ORF Clone, Human, C-OFPSpark® tag HG10490-ACR
    PSGL-1 / CD162 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10490-CF
    PSGL-1 / CD162 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10490-NF
    PSGL-1 / CD162 cDNA ORF Clone, Human, N-His tag HG10490-NH
    PSGL-1 / CD162 cDNA ORF Clone, Human, C-HA tag HG10490-CY
    PSGL-1 / CD162 cDNA ORF Clone, Human, N-HA tag HG10490-NY
    PSGL-1 / CD162 cDNA ORF Clone, Human, C-Myc tag HG10490-CM
    PSGL-1 / CD162 cDNA ORF Clone, Human, N-Myc tag HG10490-NM
    PSGL-1 / CD162 qPCR Primer Pairs, Human HP100511
    info info
    添加购物车成功! 添加购物车失败!