Selenoprotein M cDNA ORF Clone, Human, N-HA tag

Cat: HG13508-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Selenoprotein M Reagents
CRO Services
Product recommended

All Selenoprotein M Reagents
Selenoprotein M cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
438 bp
Description
Full length Clone DNA of Human selenoprotein M with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Selenoprotein M cDNA ORF Clone, Human, N-HA tag Alternative Names
SEPM cDNA ORF Clone, Human
Selenoprotein M Background Information

Selenoprotein M is a selenoprotein, which contains a selenocysteine (Sec) residue at its active site. The selenocysteine M is encoded by the UGA codon that normally signals translation termination. The 3' UTR of selenoprotein genes have a common stem-loop structure, the sec insertion sequence (SECIS), that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. This gene is expressed in a variety of tissues, and the protein is localized to the perinuclear structures. Selenoprotein M May function as a thiol-disulfide oxidoreductase that participates in disulfide bond formation. This protein is widely expressed and is highly expressed in brain. It is found in Cytoplasm, perinuclear region, Endoplasmic reticulum, Golgi apparatus. Localized to perinuclear structures corresponding to Golgi and endoplasmic reticulum. Experiments results have suggested that selenoprotein M may have an important role in protecting against oxidative damage in the brain and may potentially function in calcium regulation.

References
  • Reeves MA, et al. (2010) The neuroprotective functions of selenoprotein M and its role in cytosolic calcium regulation. Antioxid Redox Signal. 12(7): 809-18.
  • Lu W, et al. (2012) Reproductive function of Selenoprotein M in Chinese mitten crabs (Eriocheir sinesis). Peptides. 34(1): 168-76.
  • Garcia-Triana A, et al. (2010) Expression and silencing of Selenoprotein M (SelM) from the white shrimp Litopenaeus vannamei: effect on peroxidase activity and hydrogen peroxide concentration in gills and hepatopancreas. Comp Biochem Physiol A Mol Integr Physiol. 155(2): 200-4.
  • Selenoprotein M cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Selenoprotein M cDNA ORF Clone in Cloning Vector, Rat RG80607-U
    Selenoprotein M cDNA ORF Clone, Rat, untagged RG80607-UT
    Selenoprotein M cDNA ORF Clone, Rat, C-GFPSpark® tag RG80607-ACG
    Selenoprotein M Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80607-ACGLN
    Selenoprotein M cDNA ORF Clone, Rat, C-OFPSpark® tag RG80607-ACR
    Selenoprotein M cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80607-CF
    Selenoprotein M cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80607-NF
    Selenoprotein M cDNA ORF Clone, Rat, C-His tag RG80607-CH
    Selenoprotein M cDNA ORF Clone, Rat, N-His tag RG80607-NH
    Selenoprotein M cDNA ORF Clone, Rat, C-HA tag RG80607-CY
    Selenoprotein M cDNA ORF Clone, Rat, N-HA tag RG80607-NY
    Selenoprotein M cDNA ORF Clone, Rat, C-Myc tag RG80607-CM
    Selenoprotein M cDNA ORF Clone, Rat, N-Myc tag RG80607-NM
    Selenoprotein M qPCR Primer Pairs, Rat RP300571

    Selenoprotein M cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Selenoprotein M cDNA ORF Clone in Cloning Vector, Mouse MG53320-U
    Selenoprotein M cDNA ORF Clone, Mouse, untagged MG53320-UT
    Selenoprotein M cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53320-ACG
    Selenoprotein M Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53320-ACGLN
    Selenoprotein M cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53320-ANG
    Selenoprotein M cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53320-ACR
    Selenoprotein M cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53320-ANR
    Selenoprotein M cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53320-CF
    Selenoprotein M cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53320-NF
    Selenoprotein M cDNA ORF Clone, Mouse, C-His tag MG53320-CH
    Selenoprotein M cDNA ORF Clone, Mouse, N-His tag MG53320-NH
    Selenoprotein M cDNA ORF Clone, Mouse, C-HA tag MG53320-CY
    Selenoprotein M cDNA ORF Clone, Mouse, N-HA tag MG53320-NY
    Selenoprotein M cDNA ORF Clone, Mouse, C-Myc tag MG53320-CM
    Selenoprotein M cDNA ORF Clone, Mouse, N-Myc tag MG53320-NM

    Selenoprotein M cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Selenoprotein M cDNA ORF Clone in Cloning Vector, Human HG13508-G
    Selenoprotein M cDNA ORF Clone, Human, untagged HG13508-UT
    Selenoprotein M cDNA ORF Clone, Human, C-GFPSpark® tag HG13508-ACG
    Selenoprotein M Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13508-ACGLN
    Selenoprotein M cDNA ORF Clone, Human, N-GFPSpark® tag HG13508-ANG
    Selenoprotein M cDNA ORF Clone, Human, C-OFPSpark® tag HG13508-ACR
    Selenoprotein M cDNA ORF Clone, Human, N-OFPSpark® tag HG13508-ANR
    Selenoprotein M cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13508-CF
    Selenoprotein M cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13508-NF
    Selenoprotein M cDNA ORF Clone, Human, C-His tag HG13508-CH
    Selenoprotein M cDNA ORF Clone, Human, N-His tag HG13508-NH
    Selenoprotein M cDNA ORF Clone, Human, C-HA tag HG13508-CY
    Selenoprotein M cDNA ORF Clone, Human, C-Myc tag HG13508-CM
    Selenoprotein M cDNA ORF Clone, Human, N-Myc tag HG13508-NM
    Selenoprotein M qPCR Primer Pairs, Human HP102340
    info info
    添加购物车成功! 添加购物车失败!