SECTM1 cDNA ORF Clone, Human, N-HA tag

Cat: HG12269-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SECTM1 Reagents
CRO Services
Product recommended

All SECTM1 Reagents
SECTM1 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
747 bp
Description
Full length Clone DNA of Human secreted and transmembrane 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SECTM1 cDNA ORF Clone, Human, N-HA tag Alternative Names
K12 cDNA ORF Clone, Human
SECTM1 Background Information

Secreted and transmembrane 1 (SECTM1), also known as K12, is a transmembrane and secreted protein with characteristics of a type 1a transmembrane protein of SECTM family. It is found in a perinuclear Golgi-like pattern and thought to be involved in hematopoietic and/or immune system processes. The human K12 protein has been shown to be primarily expressed in spleen, prostate, testis, small intestine, and in peripheral blood leukocytes. The K12 protein is expressed on the cell surface in such small amounts as to preclude detection. Alternatively, it may be that K12 on the cell surface is rapidly cleaved to generate a soluble K12 protein. Immunohistochemical analysis of peripheral blood cells shows that K12 is found in leukocytes of the myeloid lineage, with the strongest staining observed in granulocytes and no detectable expression in lymphocytes. May be involved in thymocyte signaling. It had been suggested a role for thymic microenvironment-produced K12 in regulation of thymocyte signaling and cytokine release, particularly in the setting of thymus pathology where IFN-gamma is upregulated such as myasthenia gravis. In addition, as a putative natural CD7 ligand, SECTM1/K12 may be responsible for the costimulatory role it plays in T cell activation.

Full Name
secreted and transmembrane 1
References
  • Leta E, et al. (1995) Production and characterization of the extracellular domain of human CD7 antigen: further evidence that CD7 has a role in T cell signaling. Cell Immunol. 165(1): 101-9.
  • Slentz-Kesler KA, et al. (1998) Identification and characterization of K12 (SECTM1), a novel human gene that encodes a Golgi-associated protein with transmembrane and secreted isoforms. Genomics. 47(3): 327-40.
  • Lyman SD, et al. (2000) Identification of CD7 as a cognate of the human K12 (SECTM1) protein. J Biol Chem. 275(5): 3431-7.
  • Lam GK, et al. (2005) Expression of the CD7 ligand K-12 in human thymic epithelial cells: regulation by IFN-gamma. J Clin Immunol. 25(1): 41-9.
  • info info
    添加购物车成功! 添加购物车失败!