SEC22B cDNA ORF Clone, Human, N-Myc tag

Cat: HG14383-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SEC22B Reagents
CRO Services
Product recommended

All SEC22B Reagents
SEC22B cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Human SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SEC22B cDNA ORF Clone, Human, N-Myc tag Alternative Names
ERS-24 cDNA ORF Clone, Human;SEC22L1 cDNA ORF Clone, Human
SEC22B Background Information
Full Name
SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)

SEC22B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SEC22B cDNA ORF Clone in Cloning Vector, Mouse MG53072-G
SEC22B cDNA ORF Clone, Mouse, untagged MG53072-UT
SEC22B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53072-ACGLN
SEC22B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53072-ACG
SEC22B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53072-ANG
SEC22B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53072-ACR
SEC22B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53072-ANR
SEC22B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53072-CF
SEC22B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53072-NF
SEC22B cDNA ORF Clone, Mouse, C-His tag MG53072-CH
SEC22B cDNA ORF Clone, Mouse, N-His tag MG53072-NH
SEC22B cDNA ORF Clone, Mouse, C-HA tag MG53072-CY
SEC22B cDNA ORF Clone, Mouse, N-HA tag MG53072-NY
SEC22B cDNA ORF Clone, Mouse, C-Myc tag MG53072-CM
SEC22B cDNA ORF Clone, Mouse, N-Myc tag MG53072-NM

SEC22B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SEC22B cDNA ORF Clone in Cloning Vector, Human HG14383-G
SEC22B cDNA ORF Clone, Human, untagged HG14383-UT
SEC22B cDNA ORF Clone, Human, C-GFPSpark® tag HG14383-ACG
SEC22B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14383-ACGLN
SEC22B cDNA ORF Clone, Human, N-GFPSpark® tag HG14383-ANG
SEC22B cDNA ORF Clone, Human, C-OFPSpark® tag HG14383-ACR
SEC22B cDNA ORF Clone, Human, N-OFPSpark® tag HG14383-ANR
SEC22B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14383-CF
SEC22B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14383-NF
SEC22B cDNA ORF Clone, Human, C-His tag HG14383-CH
SEC22B cDNA ORF Clone, Human, N-His tag HG14383-NH
SEC22B cDNA ORF Clone, Human, C-HA tag HG14383-CY
SEC22B cDNA ORF Clone, Human, N-HA tag HG14383-NY
SEC22B cDNA ORF Clone, Human, C-Myc tag HG14383-CM
SEC22B qPCR Primer Pairs, Human HP103032
info info
添加购物车成功! 添加购物车失败!