SEC11A cDNA ORF Clone, Human, C-Myc tag

Cat: HG14168-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SEC11A Reagents
CRO Services
Product recommended

All SEC11A Reagents
SEC11A cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
540 bp
Description
Full length Clone DNA of Human SEC11 homolog A (S. cerevisiae) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SEC11A cDNA ORF Clone, Human, C-Myc tag Alternative Names
1810012E07Rik cDNA ORF Clone, Human;SEC11L1 cDNA ORF Clone, Human;sid2895 cDNA ORF Clone, Human;SPC18 cDNA ORF Clone, Human;SPCS4A cDNA ORF Clone, Human
SEC11A Background Information
Full Name
SEC11 homolog A (S. cerevisiae)

SEC11A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SEC11A cDNA ORF Clone in Cloning Vector, Mouse MG53984-U
SEC11A cDNA ORF Clone, Mouse, untagged MG53984-UT
SEC11A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53984-ACG
SEC11A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53984-ACGLN
SEC11A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53984-ANG
SEC11A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53984-ACR
SEC11A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53984-ANR
SEC11A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53984-CF
SEC11A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53984-NF
SEC11A cDNA ORF Clone, Mouse, C-His tag MG53984-CH
SEC11A cDNA ORF Clone, Mouse, N-His tag MG53984-NH
SEC11A cDNA ORF Clone, Mouse, C-HA tag MG53984-CY
SEC11A cDNA ORF Clone, Mouse, N-HA tag MG53984-NY
SEC11A cDNA ORF Clone, Mouse, C-Myc tag MG53984-CM
SEC11A cDNA ORF Clone, Mouse, N-Myc tag MG53984-NM

SEC11A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SEC11A cDNA ORF Clone in Cloning Vector, Human HG14168-G
SEC11A cDNA ORF Clone, Human, untagged HG14168-UT
SEC11A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14168-ACGLN
SEC11A cDNA ORF Clone, Human, C-GFPSpark® tag HG14168-ACG
SEC11A cDNA ORF Clone, Human, C-OFPSpark® tag HG14168-ACR
SEC11A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14168-CF
SEC11A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14168-NF
SEC11A cDNA ORF Clone, Human, C-His tag HG14168-CH
SEC11A cDNA ORF Clone, Human, N-His tag HG14168-NH
SEC11A cDNA ORF Clone, Human, C-HA tag HG14168-CY
SEC11A cDNA ORF Clone, Human, N-HA tag HG14168-NY
SEC11A cDNA ORF Clone, Human, N-Myc tag HG14168-NM
SEC11A qPCR Primer Pairs, Human HP102819
info info
添加购物车成功! 添加购物车失败!