SDF2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10950-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SDF2 Reagents
CRO Services
Product recommended

All SDF2 Reagents
SDF2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
636 bp
Description
Full length Clone DNA of Human stromal cell-derived factor 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SDF2 Background Information

Stromal derived factors (SDFs) are a loosely defined group of molecules that are generated by stromal cells. Two of the stromal derived factors, SDF-1 and SDF-4 belong to the chemokine family. Other SDFs, such as SDF-2 and SDF-5 are not well defined and their biological functions are less known. SDF-2 is first isolated from the mouse stromal cell line ST2 as a secretory protein. The amino acid sequence deduced from the murine clone and the human homolog are conserved more than 92 %, and the aa sequence of SDF-2 shows similarity to those of yeast dolichyl phosphate-D-mannose, protein mannosyltransferases. SDF-1 and its receptor are strongly indicated in the progression of various cancers including breast cancer. SDF-2, SDF2-L1, SDF-4, and SDF-5 are ubiquitously expressed in various cancer cell lines and SDF-2, SDF-4 and SDF-5 are expressed in mammary tissues. These SDFs have prognostic value and warrant further investigation in their biological functions and clinical value.

Full Name
stromal cell-derived factor 2
References
  • Hamada,T.etal.,1996,Gene.176(1-2):211-214.
  • Anjard,C.etal.,1998,Development.125(20):4067-4075.
  • Kang,H.etal.,2009,Int J Oncol.35(1):205-211. 
  • SDF2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SDF2 cDNA ORF Clone in Cloning Vector, Mouse MG50241-M
    SDF2 cDNA ORF Clone, Mouse, untagged MG50241-UT
    SDF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50241-ACG
    SDF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50241-ACGLN
    SDF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50241-ACR
    SDF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50241-CF
    SDF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50241-NF
    SDF2 cDNA ORF Clone, Mouse, C-His tag MG50241-CH
    SDF2 cDNA ORF Clone, Mouse, N-His tag MG50241-NH
    SDF2 cDNA ORF Clone, Mouse, C-HA tag MG50241-CY
    SDF2 cDNA ORF Clone, Mouse, N-HA tag MG50241-NY
    SDF2 cDNA ORF Clone, Mouse, C-Myc tag MG50241-CM
    SDF2 cDNA ORF Clone, Mouse, N-Myc tag MG50241-NM
    SDF2 qPCR Primer Pairs, Mouse MP200267

    SDF2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SDF2 cDNA ORF Clone in Cloning Vector, Human HG10950-M
    SDF2 cDNA ORF Clone, Human, untagged HG10950-UT
    SDF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10950-ACG
    SDF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10950-ACGLN
    SDF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10950-ACR
    SDF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10950-CF
    SDF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10950-NF
    SDF2 cDNA ORF Clone, Human, C-His tag HG10950-CH
    SDF2 cDNA ORF Clone, Human, N-His tag HG10950-NH
    SDF2 cDNA ORF Clone, Human, C-HA tag HG10950-CY
    SDF2 cDNA ORF Clone, Human, N-HA tag HG10950-NY
    SDF2 cDNA ORF Clone, Human, C-Myc tag HG10950-CM
    SDF2 qPCR Primer Pairs, Human HP100827
    info info
    添加购物车成功! 添加购物车失败!