Quick Order

Human SDF-2/SDF2 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Human SDF2 cDNA Clone Product Information
    NCBI RefSeq:NM_006923.2
    RefSeq ORF Size:636bp
    cDNA Description:Full length Clone DNA of Homo sapiens stromal cell-derived factor 2 with N terminal Myc tag.
    Gene Synonym:SDF2
    Species:Human
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with SDF2 qPCR primers for gene expression analysis, HP100827 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Stromal derived factors (SDFs) are a loosely defined group of molecules that are generated by stromal cells. Two of the stromal derived factors, SDF-1 and SDF-4 belong to the chemokine family. Other SDFs, such as SDF-2 and SDF-5 are not well defined and their biological functions are less known. SDF-2 is first isolated from the mouse stromal cell line ST2 as a secretory protein. The amino acid sequence deduced from the murine clone and the human homolog are conserved more than 92 %, and the aa sequence of SDF-2 shows similarity to those of yeast dolichyl phosphate-D-mannose, protein mannosyltransferases. SDF-1 and its receptor are strongly indicated in the progression of various cancers including breast cancer. SDF-2, SDF2-L1, SDF-4, and SDF-5 are ubiquitously expressed in various cancer cell lines and SDF-2, SDF-4 and SDF-5 are expressed in mammary tissues. These SDFs have prognostic value and warrant further investigation in their biological functions and clinical value.

    References
  • Hamada,T.etal.,1996,Gene.176(1-2):211-214.
  • Anjard,C.etal.,1998,Development.125(20):4067-4075.
  • Kang,H.etal.,2009,Int J Oncol.35(1):205-211. 
  • Size / Price
    Catalog: HG10950-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"