Quick Order

Human SCLY / Selenocysteine Lyase Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human SCLY cDNA Clone Product Information
NCBI RefSeq:BC007891
RefSeq ORF Size:1338bp
cDNA Description:Full length Clone DNA of Homo sapiens selenocysteine lyase with N terminal His tag.
Gene Synonym:SCL, hSCL
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

SCLY, also known as selenocysteine lyase, belongs to the class-V pyridoxal-phosphate-dependent aminotransferase family. It is a novel enzyme that exclusively decomposes L-selenocysteine into L-alanine and H2Se in various mammalian tissues. SCLY contains pyridoxal 5'-phosphate and weighs approximately 85,000. SCLY participates in selenoamino acid metabolism. It employs one cofactor, pyridoxal phosphate. Its maximum reactivity is at about pH 9.0. It was shown that 1 mol of selenocysteine is converted to equimolar amounts of alanine and H2Se. The following amino acids are insert: L-cysteine, L-serine, L-cysteine sulfinate, selenocysteamine, Se-ethyl-DL-selenocysteine, and L-selenohomocysteine. L-Cysteine (Ki, 1.0 mM) competes with L-selenocysteine (Km, 0.83mM) to inhibit the enzyme reaction.

References
  • Johansson AL. et al., 2012, PLoS One. 7 (1): e30528.
  • Collins R. et al., 2012, PLoS One. 7 (1): e30581.
  • N Esaki. et al., 1982, The Journal of Biological Chemistry. 257: 4386-91.
  • Size / Price
    Catalog: HG14905-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"