SCG5 cDNA ORF Clone, Human, C-Myc tag

Cat: HG13611-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SCG5 Reagents
CRO Services
Product recommended

All SCG5 Reagents
SCG5 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Human secretogranin V (7B2 protein) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SCG5 cDNA ORF Clone, Human, C-Myc tag Alternative Names
7B2 cDNA ORF Clone, Human;P7B2 cDNA ORF Clone, Human;SGNE1 cDNA ORF Clone, Human;SgV cDNA ORF Clone, Human
SCG5 Background Information
Full Name
secretogranin V

SCG5 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
SCG5 cDNA ORF Clone in Cloning Vector, Rhesus CG90389-G
SCG5 cDNA ORF Clone, Rhesus, untagged CG90389-UT
SCG5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90389-ACGLN
SCG5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90389-ACG
SCG5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90389-ACR
SCG5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90389-CF
SCG5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90389-NF
SCG5 cDNA ORF Clone, Rhesus, C-His tag CG90389-CH
SCG5 cDNA ORF Clone, Rhesus, N-His tag CG90389-NH
SCG5 cDNA ORF Clone, Rhesus, C-HA tag CG90389-CY
SCG5 cDNA ORF Clone, Rhesus, N-HA tag CG90389-NY
SCG5 cDNA ORF Clone, Rhesus, C-Myc tag CG90389-CM
SCG5 cDNA ORF Clone, Rhesus, N-Myc tag CG90389-NM

SCG5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SCG5 cDNA ORF Clone in Cloning Vector, Mouse MG58508-U
SCG5 cDNA ORF Clone, Mouse, untagged MG58508-UT
SCG5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58508-ACGLN
SCG5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58508-ACG
SCG5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58508-ACR
SCG5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58508-CF
SCG5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58508-NF
SCG5 cDNA ORF Clone, Mouse, C-His tag MG58508-CH
SCG5 cDNA ORF Clone, Mouse, N-His tag MG58508-NH
SCG5 cDNA ORF Clone, Mouse, C-HA tag MG58508-CY
SCG5 cDNA ORF Clone, Mouse, N-HA tag MG58508-NY
SCG5 cDNA ORF Clone, Mouse, C-Myc tag MG58508-CM
SCG5 cDNA ORF Clone, Mouse, N-Myc tag MG58508-NM

SCG5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SCG5 cDNA ORF Clone in Cloning Vector, Human HG13611-G
SCG5 cDNA ORF Clone, Human, untagged HG13611-UT
SCG5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13611-ACGLN
SCG5 cDNA ORF Clone, Human, C-GFPSpark® tag HG13611-ACG
SCG5 cDNA ORF Clone, Human, C-OFPSpark® tag HG13611-ACR
SCG5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13611-CF
SCG5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13611-NF
SCG5 cDNA ORF Clone, Human, C-His tag HG13611-CH
SCG5 cDNA ORF Clone, Human, N-His tag HG13611-NH
SCG5 cDNA ORF Clone, Human, C-HA tag HG13611-CY
SCG5 cDNA ORF Clone, Human, N-HA tag HG13611-NY
SCG5 cDNA ORF Clone, Human, N-Myc tag HG13611-NM
SCG5 qPCR Primer Pairs, Human HP102296
info info
添加购物车成功! 添加购物车失败!