SCF cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10451-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SCF Reagents
CRO Services
Product recommended

All SCF Reagents
SCF cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
822 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human KIT ligand with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.87kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SCF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SCF cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human KITLG/SCF/C-kit ligand Gene Expression validated Image 14278
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
SCF cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
C-kit ligand cDNA ORF Clone, Human;DCUA cDNA ORF Clone, Human;FPH2 cDNA ORF Clone, Human;FPHH cDNA ORF Clone, Human;Kitl cDNA ORF Clone, Human;KL-1 cDNA ORF Clone, Human;MGF cDNA ORF Clone, Human;SCF cDNA ORF Clone, Human;SF cDNA ORF Clone, Human;SHEP7 cDNA ORF Clone, Human
SCF Background Information

Similar to Kit ligand precursor (C-kit ligand) , also known as Stem cell factor (SCF), Mast cell growth factor (MGF) or Hematopoietic growth factor KL. SCF/C-kit ligand is the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. SCF/C-kit ligand stimulates the proliferation of mast cells. This protein is able to augment the proliferation of both myeloid and lymphoid hematopoietic progenitors in bone marrow culture. It may act synergistically with other cytokines, probably interleukins SCF/C-kit ligand is the ligand for the tyrosine kinase receptor c-kit, which is expressed on both primitive and mature hematopoietic progenitor cells. In vitro, SCF/C-kit ligand synergizes with other growth factors, such as granulocyte colony-stimulating factor (G-CSF), granulocyte macrophage- colony- stimulating factor, and interleukin-3 to stimulate the proliferation and differentiation of cells of the lymphoid, myeloid, erythroid, and megakaryocytic lineages. In vivo, SCF/C-kit also synergizes with other growth factors and has been shown to enhance the mobilization of peripheral blood progenitor cells in combination with G-CSF. In phase I/II clinical studies administration of the combination of SCF and G-CSF resulted in a two- to threefold increase in cells that express the CD34 antigen compared with G-CSF alone.

Full Name
KIT ligand
References
  • McNiece IK, et al. (1995) Stem cell factor. J Leukoc Biol. 58(1): 14-22.
  • Besmer P, et al. (1993) The kit-ligand (steel factor) and its receptor c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl. 1993:125-37.
  • Mekori YA, et al. (1993) IL-3-dependent murine mast cells undergo apoptosis on removal of IL-3. Prevention of apoptosis by c-kit ligand. J Immunol. 151(7): 3775-84.
  • SCF cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    SCF cDNA ORF Clone in Cloning Vector, Canine DG70010-M
    SCF cDNA ORF Clone, Canine, untagged DG70010-UT
    SCF cDNA ORF Clone, Canine, C-GFPSpark® tag DG70010-ACG
    SCF Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70010-ACGLN
    SCF cDNA ORF Clone, Canine, C-OFPSpark® tag DG70010-ACR
    SCF cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70010-CF
    SCF cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70010-NF
    SCF cDNA ORF Clone, Canine, C-His tag DG70010-CH
    SCF cDNA ORF Clone, Canine, N-His tag DG70010-NH
    SCF cDNA ORF Clone, Canine, C-HA tag DG70010-CY
    SCF cDNA ORF Clone, Canine, N-HA tag DG70010-NY
    SCF cDNA ORF Clone, Canine, C-Myc tag DG70010-CM
    SCF cDNA ORF Clone, Canine, N-Myc tag DG70010-NM

    SCF cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SCF cDNA ORF Clone in Cloning Vector, Rat RG82498-U
    SCF Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82498-ACGLN

    SCF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SCF cDNA ORF Clone in Cloning Vector, Mouse MG50487-M
    SCF cDNA ORF Clone, Mouse, untagged MG50487-UT
    SCF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50487-ACG
    SCF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50487-ACGLN
    SCF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50487-ACR
    SCF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50487-CF
    SCF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50487-NF
    SCF cDNA ORF Clone, Mouse, C-His tag MG50487-CH
    SCF cDNA ORF Clone, Mouse, N-His tag MG50487-NH
    SCF cDNA ORF Clone, Mouse, C-HA tag MG50487-CY
    SCF cDNA ORF Clone, Mouse, N-HA tag MG50487-NY
    SCF cDNA ORF Clone, Mouse, C-Myc tag MG50487-CM
    SCF cDNA ORF Clone, Mouse, N-Myc tag MG50487-NM
    SCF qPCR Primer Pairs, Mouse MP200481

    SCF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SCF cDNA ORF Clone in Cloning Vector, Human HG10451-M
    SCF cDNA ORF Clone, Human, untagged HG10451-UT
    SCF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10451-ACGLN
    SCF cDNA ORF Clone, Human, C-GFPSpark® tag HG10451-ACG
    SCF cDNA ORF Clone, Human, C-OFPSpark® tag HG10451-ACR
    SCF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10451-NF
    SCF cDNA ORF Clone, Human, C-His tag HG10451-CH
    SCF cDNA ORF Clone, Human, N-His tag HG10451-NH
    SCF cDNA ORF Clone, Human, C-HA tag HG10451-CY
    SCF cDNA ORF Clone, Human, N-HA tag HG10451-NY
    SCF cDNA ORF Clone, Human, C-Myc tag HG10451-CM
    SCF cDNA ORF Clone, Human, N-Myc tag HG10451-NM
    SCF qPCR Primer Pairs, Human HP100480
    info info
    添加购物车成功! 添加购物车失败!