Text Size:AAA

Human SR-BI/SCARB1/CD36L1 Gene ORF cDNA clone expression plasmid

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
DatasheetReviewsRelated ProductsProtocols
Human SCARB1 cDNA Clone Product Information
NCBI RefSeq:NM_005505.4
RefSeq ORF Size:1530 bp
cDNA Description:Full length Clone DNA of Homo sapiens scavenger receptor class B, member 1.
Gene Synonym:CLA1, SRB1, CLA-1, SR-BI, CD36L1, MGC138242, SCARB1
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SCARB1
Restriction Site:KpnI + XbaI(6.1kb+1.53kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 501C/T,1050T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with SCARB1 qPCR primers for gene expression analysis, HP100938 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Scavenger receptor class B, member 1 (SCARB1), also known as CD36L1, is a member of the scavenger receptor family. SCARB1 is expressed primarily in liver and non placental steroidogenic tissues, and predominantly localized to cholesterol and sphingomyelin-enriched domains within the plasma membrane. SCARB1 is proposed as a receptor for different ligands such as phospholipids, cholesterol ester, lipoproteins, phosphatidylserine and apoptotic cells, and is involved in a wide variety of physilogical processes. As a key component in the reverse cholesterol transport pathway, SCARB1 binds high density lipoproteins (HDLs) and mediates selective cholesterol uptake by a mechanism distinct from the LDL pathway. High density lipoproteins (HDLs) play a critical role in cholesterol metabolism and their plasma concentrations are inversely correlated with risk for atherosclerosis. SCARB1 may thus serve as a useful marker that predicts variation in baseline lipid levels and postprandial lipid response. The mouse SCARB1 has been shown to exert actions in determining the levels of plasma lipoprotein cholesterol and the accumulation of cholesterol stores in the adrenal gland.

References
  • Murao, K. et al., 1997, J. Biol. Chem. 272(28): 17551-17557.
  • Ikemoto, M. et al., 2000, Proc. Natl. Acad. Sci. U.S.A. 97 (12): 6538-6543.
  • Husemann, J. et al., 2001, Am. J. Pathol. 158 (3): 825-832. 
  • Williams, D.L. et al., 2001, Endocr. Res. 26 (4): 639-651.
  • Bulte, B. S. et al., 2002, J. Biol. Chem. 277 (39): 36092-36099.
  • Duncan, K.G. et al., 2002, Biochem. Biophys. Res. Commun. 292 (4): 1017-1022. 
  • Size / Price
    Catalog: HG11069-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"