SCAMP3 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14211-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All SCAMP3 Reagents
CRO Services
Product recommended

All SCAMP3 Reagents
SCAMP3 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1044 bp
Description
Full length Clone DNA of Human secretory carrier membrane protein 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SCAMP3 cDNA ORF Clone, Human, C-Myc tag Alternative Names
C1orf3 cDNA ORF Clone, Human
SCAMP3 Background Information
Full Name
secretory carrier membrane protein 3

SCAMP3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SCAMP3 cDNA ORF Clone in Cloning Vector, Rat RG81548-G

SCAMP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SCAMP3 cDNA ORF Clone in Cloning Vector, Mouse MG51425-G
SCAMP3 cDNA ORF Clone, Mouse, untagged MG51425-UT
SCAMP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51425-ACG
SCAMP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51425-ACGLN
SCAMP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51425-ANG
SCAMP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51425-ACR
SCAMP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51425-ANR
SCAMP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51425-CF
SCAMP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51425-NF
SCAMP3 cDNA ORF Clone, Mouse, C-His tag MG51425-CH
SCAMP3 cDNA ORF Clone, Mouse, N-His tag MG51425-NH
SCAMP3 cDNA ORF Clone, Mouse, C-HA tag MG51425-CY
SCAMP3 cDNA ORF Clone, Mouse, N-HA tag MG51425-NY
SCAMP3 cDNA ORF Clone, Mouse, C-Myc tag MG51425-CM
SCAMP3 cDNA ORF Clone, Mouse, N-Myc tag MG51425-NM
SCAMP3 qPCR Primer Pairs, Mouse MP201309

SCAMP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SCAMP3 cDNA ORF Clone in Cloning Vector, Human HG14211-G
SCAMP3 cDNA ORF Clone, Human, untagged HG14211-UT
SCAMP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14211-ACGLN
SCAMP3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14211-ACG
SCAMP3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14211-ACR
SCAMP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14211-CF
SCAMP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14211-NF
SCAMP3 cDNA ORF Clone, Human, C-His tag HG14211-CH
SCAMP3 cDNA ORF Clone, Human, N-His tag HG14211-NH
SCAMP3 cDNA ORF Clone, Human, C-HA tag HG14211-CY
SCAMP3 cDNA ORF Clone, Human, N-HA tag HG14211-NY
SCAMP3 cDNA ORF Clone, Human, N-Myc tag HG14211-NM
SCAMP3 qPCR Primer Pairs, Human HP102861
info info
添加购物车成功! 添加购物车失败!