SCAMP2 cDNA ORF Clone, Human, C-His tag

Cat: HG14722-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SCAMP2 Reagents
CRO Services
Product recommended

All SCAMP2 Reagents
SCAMP2 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
990 bp
Description
Full length Clone DNA of Human secretory carrier membrane protein 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SCAMP2 Background Information
Full Name
secretory carrier membrane protein 2

SCAMP2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SCAMP2 cDNA ORF Clone in Cloning Vector, Rat RG81161-U
SCAMP2 cDNA ORF Clone, Rat, untagged RG81161-UT
SCAMP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81161-ACGLN
SCAMP2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81161-ACG
SCAMP2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81161-ACR
SCAMP2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81161-CF
SCAMP2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81161-NF
SCAMP2 cDNA ORF Clone, Rat, C-His tag RG81161-CH
SCAMP2 cDNA ORF Clone, Rat, N-His tag RG81161-NH
SCAMP2 cDNA ORF Clone, Rat, C-HA tag RG81161-CY
SCAMP2 cDNA ORF Clone, Rat, N-HA tag RG81161-NY
SCAMP2 cDNA ORF Clone, Rat, C-Myc tag RG81161-CM
SCAMP2 cDNA ORF Clone, Rat, N-Myc tag RG81161-NM
SCAMP2 qPCR Primer Pairs, Rat RP301117

SCAMP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SCAMP2 cDNA ORF Clone in Cloning Vector, Mouse MG52846-G
SCAMP2 cDNA ORF Clone, Mouse, untagged MG52846-UT
SCAMP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52846-ACGLN
SCAMP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52846-ACG
SCAMP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52846-ANG
SCAMP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52846-ACR
SCAMP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52846-ANR
SCAMP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52846-CF
SCAMP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52846-NF
SCAMP2 cDNA ORF Clone, Mouse, C-His tag MG52846-CH
SCAMP2 cDNA ORF Clone, Mouse, N-His tag MG52846-NH
SCAMP2 cDNA ORF Clone, Mouse, C-HA tag MG52846-CY
SCAMP2 cDNA ORF Clone, Mouse, N-HA tag MG52846-NY
SCAMP2 cDNA ORF Clone, Mouse, C-Myc tag MG52846-CM
SCAMP2 cDNA ORF Clone, Mouse, N-Myc tag MG52846-NM

SCAMP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SCAMP2 cDNA ORF Clone in Cloning Vector, Human HG14722-G
SCAMP2 cDNA ORF Clone, Human, untagged HG14722-UT
SCAMP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14722-ACG
SCAMP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14722-ACGLN
SCAMP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14722-ACR
SCAMP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14722-CF
SCAMP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14722-NF
SCAMP2 cDNA ORF Clone, Human, N-His tag HG14722-NH
SCAMP2 cDNA ORF Clone, Human, C-HA tag HG14722-CY
SCAMP2 cDNA ORF Clone, Human, N-HA tag HG14722-NY
SCAMP2 cDNA ORF Clone, Human, C-Myc tag HG14722-CM
SCAMP2 cDNA ORF Clone, Human, N-Myc tag HG14722-NM
SCAMP2 qPCR Primer Pairs, Human HP103355
info info
添加购物车成功! 添加购物车失败!