SATB1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14960-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SATB1 Reagents
CRO Services
Product recommended

All SATB1 Reagents
SATB1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2292 bp
Description
Full length Clone DNA of Human SATB homeobox 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SATB1 Background Information
Full Name
SATB homeobox 1

SATB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SATB1 cDNA ORF Clone in Cloning Vector, Mouse MG58765-U
SATB1 cDNA ORF Clone, Mouse, untagged MG58765-UT
SATB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58765-ACGLN
SATB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58765-ACG
SATB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58765-ANG
SATB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58765-ACR
SATB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58765-ANR
SATB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58765-CF
SATB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58765-NF
SATB1 cDNA ORF Clone, Mouse, C-His tag MG58765-CH
SATB1 cDNA ORF Clone, Mouse, N-His tag MG58765-NH
SATB1 cDNA ORF Clone, Mouse, C-HA tag MG58765-CY
SATB1 cDNA ORF Clone, Mouse, N-HA tag MG58765-NY
SATB1 cDNA ORF Clone, Mouse, C-Myc tag MG58765-CM
SATB1 cDNA ORF Clone, Mouse, N-Myc tag MG58765-NM

SATB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SATB1 cDNA ORF Clone in Cloning Vector, Human HG14960-G
SATB1 cDNA ORF Clone, Human, untagged HG14960-UT
SATB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14960-ACGLN
SATB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14960-ACG
SATB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14960-ANG
SATB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14960-ACR
SATB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14960-ANR
SATB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14960-CF
SATB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14960-NF
SATB1 cDNA ORF Clone, Human, C-His tag HG14960-CH
SATB1 cDNA ORF Clone, Human, N-His tag HG14960-NH
SATB1 cDNA ORF Clone, Human, C-HA tag HG14960-CY
SATB1 cDNA ORF Clone, Human, N-HA tag HG14960-NY
SATB1 cDNA ORF Clone, Human, C-Myc tag HG14960-CM
SATB1 qPCR Primer Pairs, Human HP103589
info info
添加购物车成功! 添加购物车失败!