SAA4 cDNA ORF Clone, Human, C-HA tag

Cat: HG11311-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SAA4 Reagents
CRO Services
Product recommended

All SAA4 Reagents
SAA4 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
393 bp
Description
Full length Clone DNA of Human serum amyloid A4, constitutive with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SAA4 cDNA ORF Clone, Human, C-HA tag Alternative Names
C-SAA cDNA ORF Clone, Human;CSAA cDNA ORF Clone, Human;SAA4 cDNA ORF Clone, Human
SAA4 Background Information

SAA4 is a member of the SAA family.SAA proteins are family of apolipoproteins of high density lipoprotein (HDL). They can be separated into two distinct groups. First group (SAA1, SAA2, and SAA3) consists of acute phase reactant whose expression level increase in the blood in a response to trauma, infection, inflammation, and neoplasia. These acute phase SAAs associates with HDL during inflammation and remodel the HDL particle by displacing Apo-A1. The second distinct group consists of SAA4 and SAA5 which exist as the minor apolipoproteins on HDL, but this group of SAA constitutes more than 90% of all the SAA during homeostasis, and it is thought to play a role in the normal functioning of the HDL particle. SAA4 is a constitutively expressed protein which expressed only in humans and mice.It is connected almost completely with lipoproteins of the high density range. The physiological function of SAA4 is unknown, and its serum concentration has no association with those of other major apolipoproteins.

Full Name
serum amyloid A4, constitutive
References
  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Murphy CL, et al. (2009) AA amyloidosis associated with a mutated serum amyloid A4 protein. Mol Med. Amyloid. 16(2):84-8.
  • Prakash T, et al. (2010) Expression of conjoined genes: another mechanism for gene regulation in eukaryotes. PLoS One. 5(10):e13284.
  • SAA4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SAA4 cDNA ORF Clone in Cloning Vector, Mouse MG5A1511-U
    SAA4 cDNA ORF Clone, Mouse, untagged MG5A1511-UT
    SAA4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1511-ACGLN
    SAA4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A1511-ACG
    SAA4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A1511-ACR
    SAA4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A1511-CF
    SAA4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A1511-NF
    SAA4 cDNA ORF Clone, Mouse, C-His tag MG5A1511-CH
    SAA4 cDNA ORF Clone, Mouse, N-His tag MG5A1511-NH
    SAA4 cDNA ORF Clone, Mouse, C-HA tag MG5A1511-CY
    SAA4 cDNA ORF Clone, Mouse, N-HA tag MG5A1511-NY
    SAA4 cDNA ORF Clone, Mouse, C-Myc tag MG5A1511-CM
    SAA4 cDNA ORF Clone, Mouse, N-Myc tag MG5A1511-NM

    SAA4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SAA4 cDNA ORF Clone in Cloning Vector, Human HG11311-M
    SAA4 cDNA ORF Clone, Human, untagged HG11311-UT
    SAA4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11311-ACG
    SAA4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11311-ACGLN
    SAA4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11311-ACR
    SAA4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11311-CF
    SAA4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11311-NF
    SAA4 cDNA ORF Clone, Human, C-His tag HG11311-CH
    SAA4 cDNA ORF Clone, Human, N-His tag HG11311-NH
    SAA4 cDNA ORF Clone, Human, N-HA tag HG11311-NY
    SAA4 cDNA ORF Clone, Human, C-Myc tag HG11311-CM
    SAA4 cDNA ORF Clone, Human, N-Myc tag HG11311-NM
    SAA4 qPCR Primer Pairs, Human HP101198
    info info
    添加购物车成功! 添加购物车失败!