After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SAA4 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human SAA4 cDNA Clone Product Information
NCBI RefSeq:NM_006512.2
RefSeq ORF Size:393bp
cDNA Description:Full length Clone DNA of Homo sapiens serum amyloid A4, constitutive.
Gene Synonym:CSAA, C-SAA, SAA4
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-SAA4
Restriction Site:KpnI + XbaI (6.1kb + 0.39kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human SAA4 Gene Plasmid Map
Human SAA4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

SAA4 is a member of the SAA family.SAA proteins are family of apolipoproteins of high density lipoprotein (HDL). They can be separated into two distinct groups. First group (SAA1, SAA2, and SAA3) consists of acute phase reactant whose expression level increase in the blood in a response to trauma, infection, inflammation, and neoplasia. These acute phase SAAs associates with HDL during inflammation and remodel the HDL particle by displacing Apo-A1. The second distinct group consists of SAA4 and SAA5 which exist as the minor apolipoproteins on HDL, but this group of SAA constitutes more than 90% of all the SAA during homeostasis, and it is thought to play a role in the normal functioning of the HDL particle. SAA4 is a constitutively expressed protein which expressed only in humans and mice.It is connected almost completely with lipoproteins of the high density range. The physiological function of SAA4 is unknown, and its serum concentration has no association with those of other major apolipoproteins.

References
  • Davila S, et al. (2010) New genetic associations detected in a host response study to hepatitis B vaccine. Genes Immun. 11(3):232-8.
  • Murphy CL, et al. (2009) AA amyloidosis associated with a mutated serum amyloid A4 protein. Mol Med. Amyloid. 16(2):84-8.
  • Prakash T, et al. (2010) Expression of conjoined genes: another mechanism for gene regulation in eukaryotes. PLoS One. 5(10):e13284.
  • Size / Price
    Catalog: HG11311-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human SAA4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"