SAA1 cDNA ORF Clone, Human, untagged

Cat: HG11298-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SAA1 Reagents
CRO Services
Product recommended

All SAA1 Reagents
SAA1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
369 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation: 6 G/A not causing the amino acid variation.
Description
Full length Clone DNA of Human serum amyloid A1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 0.37kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
SAA1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SAA1 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
SAA1 cDNA ORF Clone, Human, untagged Alternative Names
PIG4 cDNA ORF Clone, Human;SAA cDNA ORF Clone, Human;SAA2 cDNA ORF Clone, Human;TP53I4 cDNA ORF Clone, Human
SAA1 Background Information
Full Name
serum amyloid A1

SAA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SAA1 cDNA ORF Clone in Cloning Vector, Mouse MG53475-U
SAA1 cDNA ORF Clone, Mouse, untagged MG53475-UT
SAA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53475-ACGLN
SAA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53475-ACG
SAA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53475-ACR
SAA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53475-CF
SAA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53475-NF
SAA1 cDNA ORF Clone, Mouse, C-His tag MG53475-CH
SAA1 cDNA ORF Clone, Mouse, N-His tag MG53475-NH
SAA1 cDNA ORF Clone, Mouse, C-HA tag MG53475-CY
SAA1 cDNA ORF Clone, Mouse, N-HA tag MG53475-NY
SAA1 cDNA ORF Clone, Mouse, C-Myc tag MG53475-CM
SAA1 cDNA ORF Clone, Mouse, N-Myc tag MG53475-NM

SAA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SAA1 cDNA ORF Clone in Cloning Vector, Human HG11298-M
SAA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11298-ACGLN
SAA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11298-ACG
SAA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11298-ACR
SAA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11298-CF
SAA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11298-NF
SAA1 cDNA ORF Clone, Human, C-His tag HG11298-CH
SAA1 cDNA ORF Clone, Human, N-His tag HG11298-NH
SAA1 cDNA ORF Clone, Human, C-HA tag HG11298-CY
SAA1 cDNA ORF Clone, Human, N-HA tag HG11298-NY
SAA1 cDNA ORF Clone, Human, C-Myc tag HG11298-CM
SAA1 cDNA ORF Clone, Human, N-Myc tag HG11298-NM
SAA1 qPCR Primer Pairs, Human HP101175
info info
添加购物车成功! 添加购物车失败!