S1PR1 cDNA ORF Clone, Human, C-Myc tag

Cat: HG12413-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All S1PR1 Reagents
CRO Services
Product recommended

All S1PR1 Reagents
S1PR1 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1149 bp
Description
Full length Clone DNA of Human sphingosine-1-phosphate receptor 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S1PR1 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CD363 cDNA ORF Clone, Human;CHEDG1 cDNA ORF Clone, Human;D1S3362 cDNA ORF Clone, Human;ECGF1 cDNA ORF Clone, Human;EDG-1 cDNA ORF Clone, Human;EDG1 cDNA ORF Clone, Human;S1P1 cDNA ORF Clone, Human
S1PR1 Background Information
Full Name
sphingosine-1-phosphate receptor 1

S1PR1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
S1PR1 cDNA ORF Clone in Cloning Vector, Rat RG82413-U
S1PR1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82413-ACGLN

S1PR1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
S1PR1 cDNA ORF Clone in Cloning Vector, Mouse MG57357-U
S1PR1 cDNA ORF Clone, Mouse, untagged MG57357-UT
S1PR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57357-ACG
S1PR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57357-ACGLN
S1PR1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57357-ANG
S1PR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57357-ACR
S1PR1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57357-ANR
S1PR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57357-CF
S1PR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57357-NF
S1PR1 cDNA ORF Clone, Mouse, C-His tag MG57357-CH
S1PR1 cDNA ORF Clone, Mouse, N-His tag MG57357-NH
S1PR1 cDNA ORF Clone, Mouse, C-HA tag MG57357-CY
S1PR1 cDNA ORF Clone, Mouse, N-HA tag MG57357-NY
S1PR1 cDNA ORF Clone, Mouse, C-Myc tag MG57357-CM
S1PR1 cDNA ORF Clone, Mouse, N-Myc tag MG57357-NM

S1PR1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
S1PR1 cDNA ORF Clone in Cloning Vector, Human HG12413-G
S1PR1 cDNA ORF Clone, Human, untagged HG12413-UT
S1PR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12413-ACGLN
S1PR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12413-ACG
S1PR1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12413-ANG
S1PR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12413-ACR
S1PR1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12413-ANR
S1PR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12413-CF
S1PR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12413-NF
S1PR1 cDNA ORF Clone, Human, C-His tag HG12413-CH
S1PR1 cDNA ORF Clone, Human, N-His tag HG12413-NH
S1PR1 cDNA ORF Clone, Human, C-HA tag HG12413-CY
S1PR1 cDNA ORF Clone, Human, N-HA tag HG12413-NY
S1PR1 cDNA ORF Clone, Human, N-Myc tag HG12413-NM
S1PR1 qPCR Primer Pairs, Human HP104767
info info
添加购物车成功! 添加购物车失败!