S100B cDNA ORF Clone, Human, N-His tag

Cat: HG10181-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All S100B Reagents
CRO Services
Product recommended

All S100B Reagents
S100B cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
279 bp
Description
Full length Clone DNA of Human S100 calcium binding protein B with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100B cDNA ORF Clone, Human, N-His tag Alternative Names
NEF cDNA ORF Clone, Human;S100 cDNA ORF Clone, Human;S100-B cDNA ORF Clone, Human;S100beta cDNA ORF Clone, Human
S100B Background Information

S100B is a member of the S100 family of proteins containing two EF-hand-type calcium-binding motifs. S100B exerts both intracellular and extracellular functions. Intracellular S100B acts as a stimulator of cell proliferation and migration and an inhibitor of apoptosis and differentiation, which might have important implications during brain, cartilage and skeletal muscle development and repair, activation of astrocytes in the course of brain damage and neurodegenerative processes, and of cardiomyocyte remodeling after infarction, as well as in melanomagenesis and gliomagenesis. As an extracellular factor, S100B engages RAGE (receptor for advanced glycation end products) in a variety of cell types with different outcomes (i.e. beneficial or detrimental, pro-proliferative or pro-differentiative) depending on the concentration attained by the protein, the cell type and the microenvironment. This calcium binding astrocyte-specific cytokine, presents a marker of astrocytic activation and reflects CNS injury. The excellent sensitivity of S100B has enabled it to confirm the existence of subtle brain injury in patients with mild head trauma, strokes, and after successful resuscitation from cardiopulmonary arrest. Recent findings provide evidence, that S100B may decrease neuronal injury and/or contribute to repair following traumatic brain injury (TBI). Hence, S100B, far from being a negative determinant of outcome, as suggested previously in the human TBI and ischemia literature, is of potential therapeutic value that could improve outcome in patients who sustain various forms of acute brain damage.

Full Name
S100 calcium binding protein B
References
  • Kleindienst A, et al. (2006) A critical analysis of the role of the neurotrophic protein S100B in acute brain injury. J Neurotrauma. 23(8): 1185-200.
  • Bloomfield SM, et al. (2007) Reliability of S100B in predicting severity of central nervous system injury. Neurocrit Care. 6(2): 121-38.
  • Donato R, et al. (2009) S100B's double life: intracellular regulator and extracellular signal. Biochim Biophys Acta. 1793(6): 1008-22.
  • Beaudeux JL. (2009) S100B protein: a novel biomarker for the diagnosis of head injury. Ann Pharm Fr. Beaudeux JL. 67(3): 187-94.
  • S100B cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    S100B cDNA ORF Clone in Cloning Vector, Rabbit TG65082-G
    S100B cDNA ORF Clone, Rabbit, untagged TG65082-UT
    S100B Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65082-ACGLN
    S100B cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65082-ACG
    S100B cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65082-ANG
    S100B cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65082-ACR
    S100B cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65082-ANR
    S100B cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65082-CF
    S100B cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65082-NF
    S100B cDNA ORF Clone, Rabbit, C-His tag TG65082-CH
    S100B cDNA ORF Clone, Rabbit, N-His tag TG65082-NH
    S100B cDNA ORF Clone, Rabbit, C-HA tag TG65082-CY
    S100B cDNA ORF Clone, Rabbit, N-HA tag TG65082-NY
    S100B cDNA ORF Clone, Rabbit, C-Myc tag TG65082-CM
    S100B cDNA ORF Clone, Rabbit, N-Myc tag TG65082-NM

    S100B cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    S100B cDNA ORF Clone in Cloning Vector, Mouse MG50986-G
    S100B cDNA ORF Clone, Mouse, untagged MG50986-UT
    S100B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50986-ACGLN
    S100B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50986-ACG
    S100B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50986-ANG
    S100B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50986-ACR
    S100B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50986-ANR
    S100B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50986-CF
    S100B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50986-NF
    S100B cDNA ORF Clone, Mouse, C-His tag MG50986-CH
    S100B cDNA ORF Clone, Mouse, N-His tag MG50986-NH
    S100B cDNA ORF Clone, Mouse, C-HA tag MG50986-CY
    S100B cDNA ORF Clone, Mouse, N-HA tag MG50986-NY
    S100B cDNA ORF Clone, Mouse, C-Myc tag MG50986-CM
    S100B cDNA ORF Clone, Mouse, N-Myc tag MG50986-NM
    S100B qPCR Primer Pairs, Mouse MP200952

    S100B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    S100B cDNA ORF Clone in Cloning Vector, Human HG10181-M
    S100B cDNA ORF Clone, Human, untagged HG10181-UT
    S100B cDNA ORF Clone, Human, C-GFPSpark® tag HG10181-ACG
    S100B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10181-ACGLN
    S100B cDNA ORF Clone, Human, N-GFPSpark® tag HG10181-ANG
    S100B cDNA ORF Clone, Human, C-OFPSpark® tag HG10181-ACR
    S100B cDNA ORF Clone, Human, N-OFPSpark® tag HG10181-ANR
    S100B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10181-CF
    S100B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10181-NF
    S100B cDNA ORF Clone, Human, C-His tag HG10181-CH
    S100B cDNA ORF Clone, Human, C-HA tag HG10181-CY
    S100B cDNA ORF Clone, Human, N-HA tag HG10181-NY
    S100B cDNA ORF Clone, Human, C-Myc tag HG10181-CM
    S100B cDNA ORF Clone, Human, N-Myc tag HG10181-NM
    S100B qPCR Primer Pairs, Human HP100249
    info info
    添加购物车成功! 添加购物车失败!