Quick Order

Human S100B Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human S100B cDNA Clone Product Information
NCBI RefSeq:NM_006272.2
RefSeq ORF Size:279bp
cDNA Description:Full length Clone DNA of Homo sapiens S100 calcium binding protein B with Flag tag.
Gene Synonym:S100B, NEF, S100, S100beta
Restriction Site:KpnI + XhoI (5.4kb + 0.33kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human S100B Gene Plasmid Map
Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human S100B Gene Expression validated Image
Human S100B ORF mammalian expression plasmid, Flag tag
[Click to enlarge image]
The plasmid was transfected into hela adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

S100B is a member of the S100 family of proteins containing two EF-hand-type calcium-binding motifs. S100B exerts both intracellular and extracellular functions. Intracellular S100B acts as a stimulator of cell proliferation and migration and an inhibitor of apoptosis and differentiation, which might have important implications during brain, cartilage and skeletal muscle development and repair, activation of astrocytes in the course of brain damage and neurodegenerative processes, and of cardiomyocyte remodeling after infarction, as well as in melanomagenesis and gliomagenesis. As an extracellular factor, S100B engages RAGE (receptor for advanced glycation end products) in a variety of cell types with different outcomes (i.e. beneficial or detrimental, pro-proliferative or pro-differentiative) depending on the concentration attained by the protein, the cell type and the microenvironment. This calcium binding astrocyte-specific cytokine, presents a marker of astrocytic activation and reflects CNS injury. The excellent sensitivity of S100B has enabled it to confirm the existence of subtle brain injury in patients with mild head trauma, strokes, and after successful resuscitation from cardiopulmonary arrest. Recent findings provide evidence, that S100B may decrease neuronal injury and/or contribute to repair following traumatic brain injury (TBI). Hence, S100B, far from being a negative determinant of outcome, as suggested previously in the human TBI and ischemia literature, is of potential therapeutic value that could improve outcome in patients who sustain various forms of acute brain damage.

  • Kleindienst A, et al. (2006) A critical analysis of the role of the neurotrophic protein S100B in acute brain injury. J Neurotrauma. 23(8): 1185-200.
  • Bloomfield SM, et al. (2007) Reliability of S100B in predicting severity of central nervous system injury. Neurocrit Care. 6(2): 121-38.
  • Donato R, et al. (2009) S100B's double life: intracellular regulator and extracellular signal. Biochim Biophys Acta. 1793(6): 1008-22.
  • Beaudeux JL. (2009) S100B protein: a novel biomarker for the diagnosis of head injury. Ann Pharm Fr. Beaudeux JL. 67(3): 187-94.
  • Size / Price
    Catalog: HG10181-M-F
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human S100B ORF mammalian expression plasmid, Flag tag
    • Human S100B Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.