S100A8 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG11138-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All S100A8 Reagents
CRO Services
Product recommended

All S100A8 Reagents
S100A8 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
282 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A8 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.33kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
S100A8 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A8 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human S100A8/MRP-8 Gene Expression validated Image 1725
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
other Green fluorescent protein / GFP Gene Plasmid Map 5609
S100A8 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
60B8AG cDNA ORF Clone, Human;CAGA cDNA ORF Clone, Human;CFAG cDNA ORF Clone, Human;CGLA cDNA ORF Clone, Human;CP-10 cDNA ORF Clone, Human;L1Ag cDNA ORF Clone, Human;MA387 cDNA ORF Clone, Human;MIF cDNA ORF Clone, Human;MRP-8 cDNA ORF Clone, Human;MRP8 cDNA ORF Clone, Human;NIF cDNA ORF Clone, Human;P8 cDNA ORF Clone, Human
S100A8 Background Information

S100A8 is a member of the S100 protein family containing 2EF-hand calcium-binding motifs. S100 proteins are involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. Altered expression of S100A8 protein is associated with various diseases and cancers. S100A8 may have an immunoregulatory role by contributing to the regulation of fetal-maternal interactions. It may play a protective role and its absence may allow infiltration by maternal cells, a process eventually manifesting as resorption. The heterodimeric S100 protein complex S100A8/A9 which has been shown to be involved in inflammatory and neoplastic disorders. The complex can induce cell proliferation, or apoptosis, inflammation, collagen synthesis, and cell migration. S100A8/A9 has emerged as important pro-inflammatory mediator in acute and chronic inflammation. More recently, increased S100A8 and S100A9 levels were also detected in various human cancers, presenting abundant expression in neoplastic tumor cells as well as infiltrating immune cells. On the one hand, S100A8/A9 is a powerful apoptotic agent produced by immune cells, making it a very fascinating tool in the battle against cancer. It spears the risk to induce auto-immune response and may serve as a lead compound for cancer-selective therapeutics. In contrast, S100A8/A9 expression in cancer cells has also been associated with tumor development, cancer invasion or metastasis. Altogether, its expression and potential cytokine-like function in inflammation and in cancer suggests that S100A8/A9 may play a key role in inflammation-associated cancer.

Full Name
S100 calcium binding protein A8
References
  • Passey RJ, et al. (1999) S100A8: emerging functions and regulation. J Leukoc Biol. 66(4): 549-56.
  • Gebhardt C, et al. (2006) S100A8 and S100A9 in inflammation and cancer. Biochem Pharmacol. 72(11): 1622-31.
  • Halayko AJ, et al. (2009) S100A8/A9: a mediator of severe asthma pathogenesis and morbidity? Can J Physiol Pharmacol. 87(10): 743-55.
  • Ghavami S, et al. (2009) S100A8/A9: a Janus-faced molecule in cancer therapy and tumorgenesis. Eur J Pharmacol. 625(1-3): 73-83.
  • Ha YS, et al. (2010) mRNA Expression of S100A8 as a Prognostic Marker for Progression of Non-Muscle-Invasive Bladder Cancer. Korean J Urol. 51(1): 15-20.
  • S100A8 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    S100A8 cDNA ORF Clone in Cloning Vector, Rhesus CG90318-G
    S100A8 cDNA ORF Clone, Rhesus, untagged CG90318-UT
    S100A8 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90318-ACGLN
    S100A8 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90318-ACG
    S100A8 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90318-ACR
    S100A8 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90318-CF
    S100A8 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90318-NF
    S100A8 cDNA ORF Clone, Rhesus, C-His tag CG90318-CH
    S100A8 cDNA ORF Clone, Rhesus, N-His tag CG90318-NH
    S100A8 cDNA ORF Clone, Rhesus, C-HA tag CG90318-CY
    S100A8 cDNA ORF Clone, Rhesus, N-HA tag CG90318-NY
    S100A8 cDNA ORF Clone, Rhesus, C-Myc tag CG90318-CM
    S100A8 cDNA ORF Clone, Rhesus, N-Myc tag CG90318-NM

    S100A8 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    S100A8 cDNA ORF Clone, Rat, untagged RG83128-UT
    S100A8 cDNA ORF Clone, Rat, C-GFPSpark® tag RG83128-ACG
    S100A8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83128-ACGLN
    S100A8 cDNA ORF Clone, Rat, C-OFPSpark® tag RG83128-ACR
    S100A8 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG83128-CF
    S100A8 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG83128-NF
    S100A8 cDNA ORF Clone, Rat, C-His tag RG83128-CH
    S100A8 cDNA ORF Clone, Rat, N-His tag RG83128-NH
    S100A8 cDNA ORF Clone, Rat, C-HA tag RG83128-CY
    S100A8 cDNA ORF Clone, Rat, N-HA tag RG83128-NY
    S100A8 cDNA ORF Clone, Rat, C-Myc tag RG83128-CM
    S100A8 cDNA ORF Clone, Rat, N-Myc tag RG83128-NM

    S100A8 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    S100A8 cDNA ORF Clone in Cloning Vector, Mouse MG50228-M
    S100A8 cDNA ORF Clone, Mouse, untagged MG50228-UT
    S100A8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50228-ACG
    S100A8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50228-ACGLN
    S100A8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50228-ACR
    S100A8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50228-CF
    S100A8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50228-NF
    S100A8 cDNA ORF Clone, Mouse, C-His tag MG50228-CH
    S100A8 cDNA ORF Clone, Mouse, N-His tag MG50228-NH
    S100A8 cDNA ORF Clone, Mouse, C-HA tag MG50228-CY
    S100A8 cDNA ORF Clone, Mouse, N-HA tag MG50228-NY
    S100A8 cDNA ORF Clone, Mouse, C-Myc tag MG50228-CM
    S100A8 cDNA ORF Clone, Mouse, N-Myc tag MG50228-NM
    S100A8 qPCR Primer Pairs, Mouse MP200255

    S100A8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    S100A8 cDNA ORF Clone in Cloning Vector, Human HG11138-M
    S100A8 cDNA ORF Clone, Human, untagged HG11138-UT
    S100A8 cDNA ORF Clone, Human, C-GFPSpark® tag HG11138-ACG
    S100A8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11138-ACGLN
    S100A8 cDNA ORF Clone, Human, C-OFPSpark® tag HG11138-ACR
    S100A8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11138-NF
    S100A8 cDNA ORF Clone, Human, C-His tag HG11138-CH
    S100A8 cDNA ORF Clone, Human, N-His tag HG11138-NH
    S100A8 cDNA ORF Clone, Human, C-HA tag HG11138-CY
    S100A8 cDNA ORF Clone, Human, N-HA tag HG11138-NY
    S100A8 cDNA ORF Clone, Human, C-Myc tag HG11138-CM
    S100A8 cDNA ORF Clone, Human, N-Myc tag HG11138-NM
    S100A8 qPCR Primer Pairs, Human HP101048
    info info
    添加购物车成功! 添加购物车失败!