After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human S100A4 cDNA Clone Product Information
NCBI RefSeq:NM_002961.2
RefSeq ORF Size:306bp
cDNA Description:Full length Clone DNA of Homo sapiens S100 calcium binding protein A4, transcript variant 1 with N terminal His tag.
Gene Synonym:S100A4, 42A, 18A2, CAPL, FSP1, MTS1, P9KA, PEL98
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10185-ACG$225
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10185-ACR$225
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10185-ANG$225
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10185-ANR$225
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10185-CF$195
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10185-CH$195
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10185-CM$195
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10185-CY$195
Human S100A4 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10185-M$75
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10185-M-F$195
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10185-M-N$195
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10185-NF$195
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10185-NH$195
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10185-NM$195
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10185-NY$195
Human S100A4 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10185-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

S100A4, also known as metastasis-associated protein Mtsl, belongs to the family of small calcium-binding S100 proteins containing two EF-hand calcium-binding motifs. In humans at least 20 S100 family members that are distributed tissue specifically have been identified, and are involved in a number of cellular processes as transducers of calcium signal. S100A4 is a symmetric homodimer, and undergoes a relatively large conformational change upon the typical EF-hand binding calcium, which is necessary for S100A4 to interact with its protein targets and generate biological effects. It can bind the already known targets p53, F-actin, liprin β, myosin heavy chain II, and prevent their phosphorylation and multimerization. It has been demonstrated that S100A4 is directly involved in tumor metastasis including cell motility, invasion, apoptosis, angiogenesis and differentiation, and appears to be a metastasis factor and a molecular marker for clinical prognosis. Multiple alternatively spliced variants encoding the same protein have been identified.

References
  • Ambartsumian N. et al., 1995, Gene. 159: 125-30.
  • Marenholz I. et al., 2004, Biochem Biophys Res Commun. 322: 1111-22.
  • Helfman DM. et al., 2005, Br J Cancer. 92: 1955-8.
  • Saleem M. et al., 2006, Proc Natl Acad Sci. 103: 14825-30.
  • Boye K. et al., 2008, Int J Cancer. 123: 1301-10.
  • Garrett SC. et al., 2006, J Biol Chem. 281: 677-80.
  • Kriajevska M. et al., 2002, J Biol Chem. 277: 5299-335.
  • Size / Price
    Catalog: HG10185-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"