S100A3 cDNA ORF Clone, Human, C-His tag

Cat: HG11136-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All S100A3 Reagents
CRO Services
Product recommended

All S100A3 Reagents
S100A3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
306 bp
Description
Full length Clone DNA of Human S100 calcium binding protein A3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A3 cDNA ORF Clone, Human, C-His tag Alternative Names
S100E cDNA ORF Clone, Human
S100A3 Background Information

Protein S100-A3, also known as Protein S-100E, S100 calcium-binding protein A3, S100A3 and S100E, is a member of the S-100 family. S100A3 / S100E contains 2 EF-hand domains. S100A3 / S100E is highly expressed in the differentiating cuticular cells within the hair follicle and organized into mature hair cuticles. High concentrations of S100A3 homotetramer might provide the millimolar level of Ca2+ required for hair cuticular barrier formation. S100A3 / S100E is a unique member of the Ca2+-binding S100 protein family with the highest cysteine content and affinity for Zn2+. S100A3 / S100E binds both calcium and zinc. S100A3 / S100E probably binds 2 zinc ions per molecule. It may be involved in calcium-dependent cuticle cell differentiation and hair shaft formation. S100A3 plays an important role in calcium-dependent processes leading to hair shaft formation. S100A3 / S100E is a unique protein among all members of the calcium-binding S100 family, is specifically expressed at the inner endocuticle of human hair fibers. Upon hair damage, S100A3 / S100E is released from hair fibers and possibly destabilizes the hair tissue architecture.

Full Name
S100 calcium binding protein A3
References
  • Kizawa, K. et al., 2008, J Biol Chem. 283 (8):5004-13.
  • Kizawa, K. et al., 1998, J Invest Dermatol. 111 (5):879-86.
  • Kizawa, K. et al., 2002, Biochem Biophys Res Commun. 299 (5):857-62.
  • Fritz,G. et al., 2002, J Biol Chem. 277 (36):33092-8.
  • S100A3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    S100A3 cDNA ORF Clone in Cloning Vector, Mouse MG50428-M
    S100A3 cDNA ORF Clone, Mouse, untagged MG50428-UT
    S100A3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50428-ACG
    S100A3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50428-ACGLN
    S100A3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50428-ANG
    S100A3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50428-ACR
    S100A3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50428-ANR
    S100A3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50428-CF
    S100A3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50428-NF
    S100A3 cDNA ORF Clone, Mouse, C-His tag MG50428-CH
    S100A3 cDNA ORF Clone, Mouse, N-His tag MG50428-NH
    S100A3 cDNA ORF Clone, Mouse, C-HA tag MG50428-CY
    S100A3 cDNA ORF Clone, Mouse, N-HA tag MG50428-NY
    S100A3 cDNA ORF Clone, Mouse, C-Myc tag MG50428-CM
    S100A3 cDNA ORF Clone, Mouse, N-Myc tag MG50428-NM
    S100A3 qPCR Primer Pairs, Mouse MP200438

    S100A3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    S100A3 cDNA ORF Clone in Cloning Vector, Human HG11136-M
    S100A3 cDNA ORF Clone, Human, untagged HG11136-UT
    S100A3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11136-ACGLN
    S100A3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11136-ACG
    S100A3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11136-ANG
    S100A3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11136-ACR
    S100A3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11136-ANR
    S100A3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11136-CF
    S100A3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11136-NF
    S100A3 cDNA ORF Clone, Human, N-His tag HG11136-NH
    S100A3 cDNA ORF Clone, Human, C-HA tag HG11136-CY
    S100A3 cDNA ORF Clone, Human, N-HA tag HG11136-NY
    S100A3 cDNA ORF Clone, Human, C-Myc tag HG11136-CM
    S100A3 cDNA ORF Clone, Human, N-Myc tag HG11136-NM
    S100A3 qPCR Primer Pairs, Human HP101046
    info info
    添加购物车成功! 添加购物车失败!