S100A14 cDNA ORF Clone, Human, N-HA tag

Cat: HG12251-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All S100A14 Reagents
CRO Services
Product recommended

All S100A14 Reagents
S100A14 cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
315 bp
Description
Full length Clone DNA of Human S100 calcium binding protein A14 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A14 cDNA ORF Clone, Human, N-HA tag Alternative Names
BCMP84 cDNA ORF Clone, Human;S100A15 cDNA ORF Clone, Human
S100A14 Background Information

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. 
Protein S100-A14, also known as S100 calcium-binding protein A14, S114 and S100A14, is a cytoplasm protein which belongs to the S-100 family. It is expressed at highest levels in colon and at moderate levels in thymus, kidney, liver, small intestine, and lung. Low expression in heart and no expression is seen in brain, skeletal muscle, spleen, placenta and peripheral blood leukocytes.

Full Name
S100 calcium binding protein A14
References
  • Pietas A., et al., 2002, Genomics 79: 513-22.
  • Donato, R. et al., 2003, Microsc. Res. Tech. 60 (6): 540-51.
  • Gebhardt, C. et al., 2006,  Biochem Pharmacol. 72 (11):1622-31.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-9.
  • Lim, SY. et al., 2008,  J Immunol. 181 (8): 5627-36.
  • Heibeck T.H. et al., 2009, J. Proteome Res. 8:3852-61.
  • S100A14 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    S100A14 cDNA ORF Clone, Mouse, untagged MG5A4703-UT
    S100A14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4703-ACGLN
    S100A14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4703-ACG
    S100A14 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4703-ANG
    S100A14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4703-ACR
    S100A14 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4703-ANR
    S100A14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4703-CF
    S100A14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4703-NF
    S100A14 cDNA ORF Clone, Mouse, C-His tag MG5A4703-CH
    S100A14 cDNA ORF Clone, Mouse, N-His tag MG5A4703-NH
    S100A14 cDNA ORF Clone, Mouse, C-HA tag MG5A4703-CY
    S100A14 cDNA ORF Clone, Mouse, N-HA tag MG5A4703-NY
    S100A14 cDNA ORF Clone, Mouse, C-Myc tag MG5A4703-CM
    S100A14 cDNA ORF Clone, Mouse, N-Myc tag MG5A4703-NM

    S100A14 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    S100A14 cDNA ORF Clone in Cloning Vector, Human HG12251-G
    S100A14 cDNA ORF Clone, Human, untagged HG12251-UT
    S100A14 cDNA ORF Clone, Human, C-GFPSpark® tag HG12251-ACG
    S100A14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12251-ACGLN
    S100A14 cDNA ORF Clone, Human, N-GFPSpark® tag HG12251-ANG
    S100A14 cDNA ORF Clone, Human, C-OFPSpark® tag HG12251-ACR
    S100A14 cDNA ORF Clone, Human, N-OFPSpark® tag HG12251-ANR
    S100A14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12251-CF
    S100A14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12251-NF
    S100A14 cDNA ORF Clone, Human, C-His tag HG12251-CH
    S100A14 cDNA ORF Clone, Human, N-His tag HG12251-NH
    S100A14 cDNA ORF Clone, Human, C-HA tag HG12251-CY
    S100A14 cDNA ORF Clone, Human, C-Myc tag HG12251-CM
    S100A14 cDNA ORF Clone, Human, N-Myc tag HG12251-NM
    S100A14 qPCR Primer Pairs, Human HP101867
    info info
    添加购物车成功! 添加购物车失败!