S100A13 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10991-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All S100A13 Reagents
CRO Services

All S100A13 Reagents
S100A13 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
297 bp
Sequence Description
Same as Gene Bank Ref. ID sequence with the nucleotide 291-294 deletion mutation.
Description
ORF Clone of Human S100 calcium binding protein A13 DNA.
Plasmid
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
S100A13 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

S100A13 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human CCL22/MDC Gene Plasmid Map 7197
S100A13 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
OTTHUMP00000034802 cDNA ORF Clone, Human;protein S100-A13 cDNA ORF Clone, Human;S100 calcium-binding protein A13 cDNA ORF Clone, Human
S100A13 Background Information

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.  Protein S100-A13, also known as S100 calcium-binding protein A13, is a member of the S-100 family. It contains two EF-hand domains. S100A13 binds two calcium ions per subunit and one copper ion. Binding of one copper ion does not interfere with calcium binding. S100A13 is required for the copper-dependent stress-induced export of IL1A and FGF1. The calcium-free protein binds to lipid vesicles containing phosphatidylserine, but not to vesicles containing phosphatidylcholine. S100A13 plays a role in the export of proteins that lack a signal peptide and are secreted by an alternative pathway.

Full Name
S100 calcium binding protein A13
References
  • Mandinova A. et al., 2003, J Cell Sci. 116: 2687-96.
  • Arnesano F. et al., 2005, Angew Chem Int Ed. 44: 6341-4.
  • Viemann D. et al., 2005, Blood. 105: 2955-62.
  • Nakatani Y. et al., 2005, Mediators Inflamm. 2005: 280-92.
  • Bjoerk P. et al., 2009, PLoS Biol. 7: E97-E97.
  • info info
    添加购物车成功! 添加购物车失败!