RAF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10657-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RAF1 Reagents
CRO Services
Product recommended

All RAF1 Reagents
RAF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1947 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human v-raf-1 murine leukemia viral oncogene homolog 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.99kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RAF1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
Human Raf-1/RAF1 Gene Expression validated Image 16456
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
RAF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
c-Raf cDNA ORF Clone, Human;CMD1NN cDNA ORF Clone, Human;CRAF cDNA ORF Clone, Human;NS5 cDNA ORF Clone, Human;Raf-1 cDNA ORF Clone, Human
RAF1 Background Information

RAF1 gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
Raf-1 proto-oncogene, serine/threonine kinase
References
  • Zhang K, Chen H, Zhang B, et al. Overexpression of Raf-1 and ERK1/2 in sacral chordoma and association with tumor recurrence. International Journal of Clinical and Experimental Pathology. 2015;8(1):608-614.
  • RAF1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RAF1 cDNA ORF Clone in Cloning Vector, Mouse MG50287-M
    RAF1 cDNA ORF Clone, Mouse, untagged MG50287-UT
    RAF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50287-ACGLN
    RAF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50287-ACG
    RAF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50287-ACR
    RAF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50287-CF
    RAF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50287-NF
    RAF1 cDNA ORF Clone, Mouse, C-His tag MG50287-CH
    RAF1 cDNA ORF Clone, Mouse, N-His tag MG50287-NH
    RAF1 cDNA ORF Clone, Mouse, C-HA tag MG50287-CY
    RAF1 cDNA ORF Clone, Mouse, N-HA tag MG50287-NY
    RAF1 cDNA ORF Clone, Mouse, C-Myc tag MG50287-CM
    RAF1 cDNA ORF Clone, Mouse, N-Myc tag MG50287-NM
    RAF1 qPCR Primer Pairs, Mouse MP200311

    RAF1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RAF1 cDNA ORF Clone in Cloning Vector, Human HG10657-M
    RAF1 cDNA ORF Clone, Human, untagged HG10657-UT
    RAF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10657-ACG
    RAF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10657-ACGLN
    RAF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10657-ANG
    RAF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10657-ACR
    RAF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10657-ANR
    RAF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10657-CF
    RAF1 cDNA ORF Clone, Human, C-His tag HG10657-CH
    RAF1 cDNA ORF Clone, Human, N-His tag HG10657-NH
    RAF1 cDNA ORF Clone, Human, C-HA tag HG10657-CY
    RAF1 cDNA ORF Clone, Human, N-HA tag HG10657-NY
    RAF1 cDNA ORF Clone, Human, C-Myc tag HG10657-CM
    RAF1 cDNA ORF Clone, Human, N-Myc tag HG10657-NM
    RAF1 qPCR Primer Pairs, Human HP100627
    info info
    添加购物车成功! 添加购物车失败!