After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Raf-1/RAF1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human RAF1 cDNA Clone Product Information
NCBI RefSeq:NM_002880.3
RefSeq ORF Size:1947bp
cDNA Description:Full length Clone DNA of Homo sapiens v-raf-1 murine leukemia viral oncogene homolog 1.
Gene Synonym:NS5, CRAF, Raf-1, c-Raf
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-RAF1
Restriction Site:KpnI + XbaI (6.1kb + 1.95kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RAF1 Gene Plasmid Map
Human Raf-1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG10657-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human Raf-1 natural ORF mammalian expression plasmid
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"