Text Size:AAA

Human Raf-1/RAF1 Gene ORF cDNA clone expression plasmid

  • Human Raf-1 natural ORF mammalian expression plasmid
DatasheetReviewsRelated ProductsProtocols
Human RAF1 cDNA Clone Product Information
NCBI RefSeq:NM_002880.3
RefSeq ORF Size:1947bp
cDNA Description:Full length Clone DNA of Homo sapiens v-raf-1 murine leukemia viral oncogene homolog 1.
Gene Synonym:NS5, CRAF, Raf-1, c-Raf
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-RAF1
Restriction Site:KpnI + XbaI (6.1kb + 1.95kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with RAF1 qPCR primers for gene expression analysis, HP100627 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RAF1 Gene Plasmid Map
Human Raf-1 natural ORF mammalian expression plasmid
Product nameProduct name
Background

RAF1 gene is the cellular homolog of viral raf gene (v-raf). The encoded protein is a MAP kinase kinase kinase (MAP3K), which functions downstream of the Ras family of membrane associated GTPases to which it binds directly. Once activated, the cellular RAF1 protein can phosphorylate to activate the dual specificity protein kinases MEK1 and MEK2, which in turn phosphorylate to activate the serine/threonine specific protein kinases, ERK1 and ERK2. Activated ERKs are pleiotropic effectors of cell physiology and play an important role in the control of gene expression involved in the cell division cycle, apoptosis, cell differentiation and cell migration. Mutations in this gene are associated with Noonan syndrome 5 and LEOPARD syndrome 2.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Size / Price
Catalog: HG10657-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"