Quick Order

Human APAP-1 / AAP1 / RYBP Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human RYBP cDNA Clone Product Information
NCBI RefSeq:BC014959
RefSeq ORF Size:687bp
cDNA Description:Full length Clone DNA of Homo sapiens RING1 and YY1 binding protein with N terminal His tag.
Gene Synonym:AAP1, DEDAF, YEAF1, RYBP
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

APAP-1, also known as AAP1 and RYBP, is widely expressed. It is highest expressed in lymphoid tissues and placenta. APAP-1 contains 1 RanBP2-type zinc finger. It may bind to DNA. APAP-1 inhibits ubiquitination and subsequent degradation of TP53, and thereby plays a role in regulating transcription of TP53 target genes. It may be implicated in the regulation of the transcription as a repressor of the transcriptional activity of E4TF1. APAP-1 also promotes apoptosis.

References
  • Li Mao, et al. (2009) RYBP stabilizes p53 by modulating MDM2. EMBO Rep. 10(2):166-72.
  • Schlisio, et al. (2002) Interaction of YY1 with E2Fs, mediated by RYBP, provides a mechanism for specificity of E2F function. EMBO J. 21(21):5775-86.
  • Peter M E, et al. (2001) The death effector domain-associated factor plays distinct regulatory roles in the nucleus and cytoplasm. J Biol Chem. 276(34):31945-52.
  • Size / Price
    Catalog: HG14292-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"