After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RUVBL1 / RVB1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human RUVBL1 cDNA Clone Product Information
NCBI RefSeq:BC004531
RefSeq ORF Size:1371bp
cDNA Description:Full length Clone DNA of Homo sapiens RuvB-like 1 (E. coli) with C terminal His tag.
Gene Synonym:RVB1, TIH1, ECP54, TIP49, INO80H, NMP238, PONTIN, TIP49A, Pontin52
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

RUVBL1, also known as RVB1, is a component of the NuA4 histone acetyltransferase complex and belongs to the RuvB family. RUVBL1 is ubiquitously expressed with high expression in heart, skeletal muscle and testis. It possesses single-stranded DNA-stimulated ATPase and ATP-dependent DNA helicase (3' to 5') activity. RUVBL1 is involved in transcriptional activation of select genes principally by acetylation of nucleosomal histones H4 and H2A. RUVBL1 plays an essential role in oncogenic transformation by MYC and also modulates transcriptional activation by the LEF1/TCF1-CTNNB1 complex. It also is essential for cell proliferation. RUVBL1 may be able to bind plasminogen at cell surface and enhance plasminogen activation.

References
  • Bauer A, et al. (1998) Pontin52, an interaction partner of beta-catenin, binds to the TATA box binding protein. Proc Natl Acad Sci. 95(25):14787-92.
  • Ewing, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Puri T, et al. (2007) Dodecameric structure and ATPase activity of the human TIP48/TIP49 complex. J Mol Biol. 366(1):179-92.
  • Size / Price
    Catalog: HG14074-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"