Nogo Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10466-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Nogo Receptor Reagents
CRO Services
Product recommended

All Nogo Receptor Reagents
Nogo Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1422 bp
Description
Full length Clone DNA of Human reticulon 4 receptor with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Nogo Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
NGR cDNA ORF Clone, Human;NOGOR cDNA ORF Clone, Human
Nogo Receptor Background Information

Reticulon 4 receptor (RTN4R), also known as Nogo-66 Receptor (NgR), is a glycosylphosphoinositol (GPI)-anchored protein that belongs to the Nogo recptor family including three members. Mouse RTN4R cDNA contains 10 LRP (Leucine-rich) repeats. RTN4R is expressed predominantly in neurons and their axons in the central nervous systems (CNS). As a receptor for myelin-derived proteins Nogo, myelin-associated glycoprotein (MAG), and myelin oligodendrocyte glycoprotein (OMG), RTN4R mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult CNS. It has been shown that RTN4R performs its inhibitory actions by interacting with the p75 neurotrophin receptor (p75NTR), a TNFRSF member also known for modulating the activities of the Trk family and for inducing apoptosis in neurons and oligodendrocytes. RTN4R may be proposed as a potential drug target for treatment of various neurological conditions such as spinal cord injury, CNS lesions, peripheral nerve injury, stroke and Alzheimer's disease (AD). Additionally, RTN4R may play a role in regulating the function of the gap junctions.

Full Name
reticulon 4 receptor
References

1. Wang, X. et al., 2006, Ann Neurol. 60(5): 540-549.      

2. Wang, Y.Z. et al., 2006, Neuroreport.17(6):605-609.       

3. Zhu, H.Y. et al., 2007, Hum Pathol. 38(3): 426-434.           

4. David, S. et al., 2008, Trends Neurosci. 31(5): 221-226.       

5. Jiang, W. et al., 2009, Transl Res. 154(1): 40-48.      

6. Zhang, L. et al., 2009, J Neurosci, 9(19): 6348-6352.

Nogo Receptor cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Nogo Receptor cDNA ORF Clone in Cloning Vector, Mouse MG50106-M
Nogo Receptor cDNA ORF Clone, Mouse, untagged MG50106-UT
Nogo Receptor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50106-ACG
Nogo Receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50106-ACGLN
Nogo Receptor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50106-ACR
Nogo Receptor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50106-CF
Nogo Receptor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50106-NF
Nogo Receptor cDNA ORF Clone, Mouse, C-His tag MG50106-CH
Nogo Receptor cDNA ORF Clone, Mouse, N-His tag MG50106-NH
Nogo Receptor cDNA ORF Clone, Mouse, C-HA tag MG50106-CY
Nogo Receptor cDNA ORF Clone, Mouse, N-HA tag MG50106-NY
Nogo Receptor cDNA ORF Clone, Mouse, C-Myc tag MG50106-CM
Nogo Receptor cDNA ORF Clone, Mouse, N-Myc tag MG50106-NM
Nogo Receptor qPCR Primer Pairs, Mouse MP200136

Nogo Receptor cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Nogo Receptor cDNA ORF Clone in Cloning Vector, Human HG10466-M
Nogo Receptor cDNA ORF Clone, Human, untagged HG10466-UT
Nogo Receptor Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10466-ACGLN
Nogo Receptor cDNA ORF Clone, Human, C-GFPSpark® tag HG10466-ACG
Nogo Receptor cDNA ORF Clone, Human, C-OFPSpark® tag HG10466-ACR
Nogo Receptor cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10466-NF
Nogo Receptor cDNA ORF Clone, Human, C-His tag HG10466-CH
Nogo Receptor cDNA ORF Clone, Human, N-His tag HG10466-NH
Nogo Receptor cDNA ORF Clone, Human, C-HA tag HG10466-CY
Nogo Receptor cDNA ORF Clone, Human, N-HA tag HG10466-NY
Nogo Receptor cDNA ORF Clone, Human, C-Myc tag HG10466-CM
Nogo Receptor cDNA ORF Clone, Human, N-Myc tag HG10466-NM
Nogo Receptor qPCR Primer Pairs, Human HP100492
info info
添加购物车成功! 添加购物车失败!