RTN4 cDNA ORF Clone, Human, C-Myc tag

Cat: HG12261-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RTN4 Reagents
CRO Services

All RTN4 Reagents
RTN4 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
600 bp
Description
Full length Clone DNA of Human reticulon 4 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RTN4 cDNA ORF Clone, Human, C-Myc tag Alternative Names
ASY cDNA ORF Clone, Human;DGU cDNA ORF Clone, Human;DKFZp781L1143 cDNA ORF Clone, Human;HIGM4 cDNA ORF Clone, Human;Nbla00271 cDNA ORF Clone, Human;Nbla10545 cDNA ORF Clone, Human;NI220/250 cDNA ORF Clone, Human;NOGO cDNA ORF Clone, Human;NOGO-A cDNA ORF Clone, Human;Nogo-B cDNA ORF Clone, Human;Nogo-C cDNA ORF Clone, Human;NOGOC cDNA ORF Clone, Human;NSP cDNA ORF Clone, Human;NSP-CL cDNA ORF Clone, Human;RTN-X cDNA ORF Clone, Human;RTN4-A cDNA ORF Clone, Human;RTN4-B1 cDNA ORF Clone, Human;RTN4-B2 cDNA ORF Clone, Human;RTN4-C cDNA ORF Clone, Human;UDG cDNA ORF Clone, Human;UNG1 cDNA ORF Clone, Human;UNG15 cDNA ORF Clone, Human;UNG2 cDNA ORF Clone, Human
RTN4 Background Information

Reticulon-4, also known as Foocen, Neurite outgrowth inhibitor, Nogo protein, Neuroendocrine-specific protein, Neuroendocrine-specific protein C homolog, RTN-x, Reticulon-5 and RTN4, is a multi-pass membrane protein which contains one reticulon domain. Isoform 1 of RTN4 is specifically expressed in brain and testis and weakly in heart and skeletal muscle. Isoform 2 of RTN4 is widely expressed except for the liver. Isoform 3 of RTN4 is expressed in brain, skeletal muscle and adipocytes. Isoform 4 of RTN4 is testis-specific. Reticulon-4 / RTN4 is a developmental neurite growth regulatory factor with a role as a negative regulator of axon-axon adhesion and growth, and as a facilitator of neurite branching. Reticulon-4 / RTN4 regulates neurite fasciculation, branching and extension in the developing nervous system. Reticulon-4 / RTN4 is involved in down-regulation of growth, stabilization of wiring and restriction of plasticity in the adult CNS. It regulates the radial migration of cortical neurons via an RTN4R-LINGO1 containing receptor complex. Isoform 2 of RTN4 reduces the anti-apoptotic activity of Bcl-xl and Bcl-2. This is likely consecutive to their change in subcellular location, from the mitochondria to the endoplasmic reticulum, after binding and sequestration. Isoform 2 and isoform 3 of RTN4 inhibit BACE1 activity and amyloid precursor protein processing.

Full Name
reticulon 4
References
  • Yang J., et al., 2000, Cytogenet. Cell Genet. 88:101-102.
  • Prinjha R., et al., 2000, Nature 403: 383-384.
  • Tagami S., et al., 2000, Oncogene 19: 5736-5746.
  • Murayama K.S., et al., 2006, Eur. J. Neurosci. 24: 1237-1244.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Choudhary C., et al., 2009, Science 325: 834-840.
  • RTN4 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RTN4 cDNA ORF Clone in Cloning Vector, Mouse MG57427-U
    RTN4 cDNA ORF Clone, Mouse, untagged MG57427-UT
    RTN4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57427-ACGLN
    RTN4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57427-ACG
    RTN4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57427-ANG
    RTN4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57427-ACR
    RTN4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57427-ANR
    RTN4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57427-CF
    RTN4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57427-NF
    RTN4 cDNA ORF Clone, Mouse, C-His tag MG57427-CH
    RTN4 cDNA ORF Clone, Mouse, N-His tag MG57427-NH
    RTN4 cDNA ORF Clone, Mouse, C-HA tag MG57427-CY
    RTN4 cDNA ORF Clone, Mouse, N-HA tag MG57427-NY
    RTN4 cDNA ORF Clone, Mouse, C-Myc tag MG57427-CM
    RTN4 cDNA ORF Clone, Mouse, N-Myc tag MG57427-NM

    RTN4 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RTN4 cDNA ORF Clone in Cloning Vector, Human HG13030-G
    RTN4 cDNA ORF Clone, Human, untagged HG13030-UT
    RTN4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13030-ACGLN
    RTN4 cDNA ORF Clone, Human, C-GFPSpark® tag HG13030-ACG
    RTN4 cDNA ORF Clone, Human, N-GFPSpark® tag HG13030-ANG
    RTN4 cDNA ORF Clone, Human, C-OFPSpark® tag HG13030-ACR
    RTN4 cDNA ORF Clone, Human, N-OFPSpark® tag HG13030-ANR
    RTN4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13030-CF
    RTN4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13030-NF
    RTN4 cDNA ORF Clone, Human, C-His tag HG13030-CH
    RTN4 cDNA ORF Clone, Human, N-His tag HG13030-NH
    RTN4 cDNA ORF Clone, Human, C-HA tag HG13030-CY
    RTN4 cDNA ORF Clone, Human, N-HA tag HG13030-NY
    RTN4 cDNA ORF Clone, Human, C-Myc tag HG13030-CM
    RTN4 cDNA ORF Clone, Human, N-Myc tag HG13030-NM
    RTN4 qPCR Primer Pairs, Human HP101927
    info info
    添加购物车成功! 添加购物车失败!