After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human RTN4/NOGO-A Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human RTN4 cDNA Clone Product Information
NCBI RefSeq:BC001035
RefSeq ORF Size:600bp
cDNA Description:Full length Clone DNA of Homo sapiens reticulon 4 with N terminal HA tag.
Gene Synonym:ASY, NSP, NOGO, NOGOC, RTN-X, NOGO-A, NSP-CL, Nogo-B, Nogo-C, RTN4-A, RTN4-C, RTN4-B1, RTN4-B2, NI220/250, Nbla00271, RTN4Nbla10545
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Reticulon-4, also known as Foocen, Neurite outgrowth inhibitor, Nogo protein, Neuroendocrine-specific protein, Neuroendocrine-specific protein C homolog, RTN-x, Reticulon-5 and RTN4, is a multi-pass membrane protein which contains one reticulon domain. Isoform 1 of RTN4 is specifically expressed in brain and testis and weakly in heart and skeletal muscle. Isoform 2 of RTN4 is widely expressed except for the liver. Isoform 3 of RTN4 is expressed in brain, skeletal muscle and adipocytes. Isoform 4 of RTN4 is testis-specific. Reticulon-4 / RTN4 is a developmental neurite growth regulatory factor with a role as a negative regulator of axon-axon adhesion and growth, and as a facilitator of neurite branching. Reticulon-4 / RTN4 regulates neurite fasciculation, branching and extension in the developing nervous system. Reticulon-4 / RTN4 is involved in down-regulation of growth, stabilization of wiring and restriction of plasticity in the adult CNS. It regulates the radial migration of cortical neurons via an RTN4R-LINGO1 containing receptor complex. Isoform 2 of RTN4 reduces the anti-apoptotic activity of Bcl-xl and Bcl-2. This is likely consecutive to their change in subcellular location, from the mitochondria to the endoplasmic reticulum, after binding and sequestration. Isoform 2 and isoform 3 of RTN4 inhibit BACE1 activity and amyloid precursor protein processing.

References
  • Yang J., et al., 2000, Cytogenet. Cell Genet. 88:101-102.
  • Prinjha R., et al., 2000, Nature 403: 383-384.
  • Tagami S., et al., 2000, Oncogene 19: 5736-5746.
  • Murayama K.S., et al., 2006, Eur. J. Neurosci. 24: 1237-1244.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Choudhary C., et al., 2009, Science 325: 834-840.
  • Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"