RTN3 cDNA ORF Clone, Human, N-His tag

Cat: HG14259-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RTN3 Reagents

CRO Services

Product recommended


All RTN3 Reagents

RTN3 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Human reticulon 3 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RTN3 cDNA ORF Clone, Human, N-His tag Alternative Names

ASYIP cDNA ORF Clone, Human;HAP cDNA ORF Clone, Human;NSPL2 cDNA ORF Clone, Human;NSPLII cDNA ORF Clone, Human;RTN3-A1 cDNA ORF Clone, Human

RTN3 Background Information

Full Name
reticulon 3

RTN3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RTN3 cDNA ORF Clone in Cloning Vector, Mouse MG51210-U
RTN3 cDNA ORF Clone, Mouse, untagged MG51210-UT
RTN3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51210-ACG
RTN3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51210-ACGLN
RTN3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51210-ANG
RTN3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51210-ACR
RTN3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51210-ANR
RTN3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51210-CF
RTN3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51210-NF
RTN3 cDNA ORF Clone, Mouse, C-His tag MG51210-CH
RTN3 cDNA ORF Clone, Mouse, N-His tag MG51210-NH
RTN3 cDNA ORF Clone, Mouse, C-HA tag MG51210-CY
RTN3 cDNA ORF Clone, Mouse, N-HA tag MG51210-NY
RTN3 cDNA ORF Clone, Mouse, C-Myc tag MG51210-CM
RTN3 cDNA ORF Clone, Mouse, N-Myc tag MG51210-NM
RTN3 qPCR Primer Pairs, Mouse MP201094

RTN3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RTN3 cDNA ORF Clone in Cloning Vector, Human HG14259-G
RTN3 cDNA ORF Clone, Human, untagged HG14259-UT
RTN3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14259-ACGLN
RTN3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14259-ACG
RTN3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14259-ACR
RTN3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14259-CF
RTN3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14259-NF
RTN3 cDNA ORF Clone, Human, C-His tag HG14259-CH
RTN3 cDNA ORF Clone, Human, C-HA tag HG14259-CY
RTN3 cDNA ORF Clone, Human, N-HA tag HG14259-NY
RTN3 cDNA ORF Clone, Human, C-Myc tag HG14259-CM
RTN3 cDNA ORF Clone, Human, N-Myc tag HG14259-NM
RTN3 qPCR Primer Pairs, Human HP102909
info info
添加购物车成功! 添加购物车失败!