RSRC1 cDNA ORF Clone, Human, untagged

Cat: HG15422-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RSRC1 Reagents
CRO Services
Product recommended

All RSRC1 Reagents
RSRC1 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Human arginine/serine-rich coiled-coil 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RSRC1 cDNA ORF Clone, Human, untagged Alternative Names
BM-011 cDNA ORF Clone, Human;SFRS21 cDNA ORF Clone, Human;SRrp53 cDNA ORF Clone, Human
RSRC1 Background Information
Full Name
arginine/serine-rich coiled-coil 1

RSRC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RSRC1 cDNA ORF Clone in Cloning Vector, Rat RG87603-U
RSRC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87603-ACGLN

RSRC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RSRC1 cDNA ORF Clone in Cloning Vector, Mouse MG53467-U
RSRC1 cDNA ORF Clone, Mouse, untagged MG53467-UT
RSRC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53467-ACG
RSRC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53467-ACGLN
RSRC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53467-ANG
RSRC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53467-ACR
RSRC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53467-ANR
RSRC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53467-CF
RSRC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53467-NF
RSRC1 cDNA ORF Clone, Mouse, C-His tag MG53467-CH
RSRC1 cDNA ORF Clone, Mouse, N-His tag MG53467-NH
RSRC1 cDNA ORF Clone, Mouse, C-HA tag MG53467-CY
RSRC1 cDNA ORF Clone, Mouse, N-HA tag MG53467-NY
RSRC1 cDNA ORF Clone, Mouse, C-Myc tag MG53467-CM
RSRC1 cDNA ORF Clone, Mouse, N-Myc tag MG53467-NM

RSRC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RSRC1 cDNA ORF Clone in Cloning Vector, Human HG15422-G
RSRC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15422-ACGLN
RSRC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15422-ACG
RSRC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15422-ANG
RSRC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15422-ACR
RSRC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15422-ANR
RSRC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15422-CF
RSRC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15422-NF
RSRC1 cDNA ORF Clone, Human, C-His tag HG15422-CH
RSRC1 cDNA ORF Clone, Human, N-His tag HG15422-NH
RSRC1 cDNA ORF Clone, Human, C-HA tag HG15422-CY
RSRC1 cDNA ORF Clone, Human, N-HA tag HG15422-NY
RSRC1 cDNA ORF Clone, Human, C-Myc tag HG15422-CM
RSRC1 cDNA ORF Clone, Human, N-Myc tag HG15422-NM
RSRC1 qPCR Primer Pairs, Human HP104046
info info
添加购物车成功! 添加购物车失败!