RSPO3 cDNA ORF Clone, Human, C-His tag

Cat: HG11185-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RSPO3 Reagents
CRO Services
Product recommended

All RSPO3 Reagents
RSPO3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
864 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 567G/A not causing the amino acid variation.
Description
Full length Clone DNA of Human R-spondin 3 homolog (Xenopus laevis) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + XbaI(6kb+0.86kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
RSPO3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RSPO3 cDNA ORF Clone, Human, C-His tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5610
RSPO3 cDNA ORF Clone, Human, C-His tag Alternative Names
CRISTIN1 cDNA ORF Clone, Human;PWTSR cDNA ORF Clone, Human;THSD2 cDNA ORF Clone, Human
RSPO3 Background Information

R-spondin 3 (RSPO3) is a member of the R-Spondin (RSPO) family in vertebrates that activate Wnt/beta-catenin signaling, plays a key role in these processes. The RSPO family of secreted Wnt modulators is involved in development and disease and holds therapeutic promise as stem cell growth factors. The four members have high structural homology. RSPO2 and RSPO3 are more potent than RSPO1, whereas RSPO4 is relatively inactive. All RSPO members require Wnt ligands and LRP6 for activity and amplify signaling of Wnt3A, Wnt1, and Wnt7A, suggesting that RSPO proteins are general regulators of canonical Wnt signaling. RSPO3/PCP signaling during gastrulation requires Wnt5a and is transduced via Fz7, Dvl, and JNK. RSPO3 functions by inducing Sdc4-dependent, clathrin-mediated endocytosis. RSPO3 is a novel, evolutionarily conserved angiogenic factor in embryogenesis. RSPO3 has a key role in the interaction between chorion and allantois in labyrinthine development.

Full Name
R-spondin 3
References
  • Aoki M, et al. (2007) R-spondin3 is required for mouse placental development. Dev Biol. 301(1): 218-26.
  • Kazanskaya O, et al. (2008) The Wnt signaling regulator R-spondin 3 promotes angioblast and vascular development. Development. 135(22): 3655-64.
  • Kim KA, et al. (2008) R-Spondin family members regulate the Wnt pathway by a common mechanism. Mol Biol Cell. 19(6): 2588-96.
  • Ohkawara B, et al. (2011) Rspo3 Binds Syndecan 4 and Induces Wnt/PCP Signaling via Clathrin-Mediated Endocytosis to Promote Morphogenesis. Dev Cell. 20(3): 303-14.
  • RSPO3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    RSPO3 cDNA ORF Clone in Cloning Vector, Mouse MG50606-M
    RSPO3 cDNA ORF Clone, Mouse, untagged MG50606-UT
    RSPO3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50606-ACGLN
    RSPO3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50606-ACG
    RSPO3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50606-ACR
    RSPO3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50606-CF
    RSPO3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50606-NF
    RSPO3 cDNA ORF Clone, Mouse, C-His tag MG50606-CH
    RSPO3 cDNA ORF Clone, Mouse, N-His tag MG50606-NH
    RSPO3 cDNA ORF Clone, Mouse, C-HA tag MG50606-CY
    RSPO3 cDNA ORF Clone, Mouse, N-HA tag MG50606-NY
    RSPO3 cDNA ORF Clone, Mouse, C-Myc tag MG50606-CM
    RSPO3 cDNA ORF Clone, Mouse, N-Myc tag MG50606-NM
    RSPO3 qPCR Primer Pairs, Mouse MP200592

    RSPO3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    RSPO3 cDNA ORF Clone in Cloning Vector, Human HG11185-M
    RSPO3 cDNA ORF Clone, Human, untagged HG11185-UT
    RSPO3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11185-ACGLN
    RSPO3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11185-ACG
    RSPO3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11185-ACR
    RSPO3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11185-CF
    RSPO3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11185-NF
    RSPO3 cDNA ORF Clone, Human, N-His tag HG11185-NH
    RSPO3 cDNA ORF Clone, Human, C-HA tag HG11185-CY
    RSPO3 cDNA ORF Clone, Human, N-HA tag HG11185-NY
    RSPO3 cDNA ORF Clone, Human, C-Myc tag HG11185-CM
    RSPO3 cDNA ORF Clone, Human, N-Myc tag HG11185-NM
    RSPO3 qPCR Primer Pairs, Human HP101091
    info info
    添加购物车成功! 添加购物车失败!