RSK4 cDNA ORF Clone, Human, N-His tag

Cat: HG10147-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RSK4 Reagents
CRO Services
Product recommended

All RSK4 Reagents
RSK4 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2238 bp
Description
Full length Clone DNA of Human ribosomal protein S6 kinase, 90kDa, polypeptide 6 (RPS6KA6) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RSK4 cDNA ORF Clone, Human, N-His tag Alternative Names
PP90RSK4 cDNA ORF Clone, Human;RSK4 cDNA ORF Clone, Human
RSK4 Background Information

Ribosomal protein S6 kinase alpha-6, also known as Ribosomal S6 kinase 4, 90 kDa ribosomal protein S6 kinase 6,RSK-4, RSK4 and RPS6KA6, is a protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and S6 kinase subfamily. RPS6KA6 contains one AGC-kinase C-terminal domain and two protein kinase domains. RPS6KA6 forms a complex with either ERK1 or ERK2 in quiescent cells. RPS6KA6 shows a high level of homology to three isolated members of the human RSK family. RSK2 is involved in Coffin-Lowry syndrome and nonspecific MRX. The localization of RPS6KA6 in the interval that is commonly deleted in mentally retarded males together with the high degree of amino acid identity with RSK2 suggests that RPS6KA6 plays a role in normal neuronal development. Further mutation analyses in males with X-linked mental retardation must prove that the gene of RPS6KA6 is indeed a novel MRX gene. RPS6KA6 is a serine/threonine kinase that may play a role in mediating the growth-factor and stress induced activation of the transcription factor CREB. RPS6KA6 is activated by multiple phosphorylations on threonine and serine residues.

Full Name
ribosomal protein S6 kinase, 90kDa, polypeptide 6
References
  • Yntema H.G., et al.,(1999), A novel ribosomal S6-kinase (RSK4; RPS6KA6) is commonly deleted in patients with complex X-linked mental retardation. Genomics 62:332-343.
  • Ross M.T., et al., (2005), The DNA sequence of the human X chromosome.Nature 434:325-337.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • info info
    添加购物车成功! 添加购物车失败!