Quick Order

Human MSK1 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human RPS6KA5 cDNA Clone Product Information
    NCBI RefSeq:NM_004755.2
    RefSeq ORF Size:2409bp
    cDNA Description:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 5, transcript variant 1 with N terminal His tag.
    Gene Synonym:MSK1, RLPK, MSPK1, MGC1911
    Species:Human
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with RPS6KA5 qPCR primers for gene expression analysis, HP100206 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Size / Price
    Catalog: HG10135-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"