Quick Order

Human RSK3/RPS6KA2 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human RPS6KA2 cDNA Clone Product Information
NCBI RefSeq:NM_021135.4
RefSeq ORF Size:2202bp
cDNA Description:Full length Clone DNA of Homo sapiens ribosomal protein S6 kinase, 90kDa, polypeptide 2 with N terminal Myc tag.
Gene Synonym:RSK, HU-2, RSK3, p90-RSK3, pp90RSK3, MAPKAPK1C, S6K-alpha, S6K-alpha2, RPS6KA2
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Ribosomal protein S6 kinase alpha-2, also known as 90 kDa ribosomal protein S6 kinase 2, MAP kinase-activated protein kinase 1c, MAPK-activated protein kinase 1c, Ribosomal S6 kinase 3, RSK-3, RPS6KA2 and MAPKAPK1C, is a nucleus protein which belongs to the protein kinase superfamily, AGC Ser/Thr protein kinase family and S6 kinase subfamily. RPS6KA2 / RSK-3 is expressed in many tissues. Highest expression is in lung and skeletal muscle. The expression of RPS6KA2 reduced proliferation, caused G1 arrest, increased apoptosis, reduced levels of phosphorylated extracellular signal-regulated kinase and altered other cell cycle proteins. RPS6KA2 / RSK-3 contains one AGC-kinase C-terminal domain and two protein kinase domains. It forms a complex with either ERK1 or ERK2 in quiescent cells. It transiently dissociates following mitogenic stimulation. RPS6KA2 / RSK-3 is a serine/threonine kinase that may play a role in mediating the growth-factor and stress induced activation of the transcription factor CREB. RPS6KA1, RPS6KA2, RPS6KB1, RPS6KB2, and PDK1 are involved in several pathways central to the carcinogenic process, including regulation of cell growth, insulin, and inflammation. 

Size / Price
Catalog: HG10833-NM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"