RPS5 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG16364-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RPS5 Reagents
CRO Services
Product recommended

All RPS5 Reagents
RPS5 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
615 bp
Description
Full length Clone DNA of Human ribosomal protein S5 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS5 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
S5 cDNA ORF Clone, Human
RPS5 Background Information
Full Name
ribosomal protein S5

RPS5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPS5 cDNA ORF Clone in Cloning Vector, Rat RG80743-U
RPS5 cDNA ORF Clone, Rat, untagged RG80743-UT
RPS5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80743-ACGLN
RPS5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80743-ACG
RPS5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80743-ANG
RPS5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80743-ACR
RPS5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80743-ANR
RPS5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80743-CF
RPS5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80743-NF
RPS5 cDNA ORF Clone, Rat, C-His tag RG80743-CH
RPS5 cDNA ORF Clone, Rat, N-His tag RG80743-NH
RPS5 cDNA ORF Clone, Rat, C-HA tag RG80743-CY
RPS5 cDNA ORF Clone, Rat, N-HA tag RG80743-NY
RPS5 cDNA ORF Clone, Rat, C-Myc tag RG80743-CM
RPS5 cDNA ORF Clone, Rat, N-Myc tag RG80743-NM
RPS5 qPCR Primer Pairs, Rat RP300707

RPS5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RPS5 cDNA ORF Clone in Cloning Vector, Mouse MG53516-G
RPS5 cDNA ORF Clone, Mouse, untagged MG53516-UT
RPS5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53516-ACGLN
RPS5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53516-ACG
RPS5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53516-ANG
RPS5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53516-ACR
RPS5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53516-ANR
RPS5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53516-CF
RPS5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53516-NF
RPS5 cDNA ORF Clone, Mouse, C-His tag MG53516-CH
RPS5 cDNA ORF Clone, Mouse, N-His tag MG53516-NH
RPS5 cDNA ORF Clone, Mouse, C-HA tag MG53516-CY
RPS5 cDNA ORF Clone, Mouse, N-HA tag MG53516-NY
RPS5 cDNA ORF Clone, Mouse, C-Myc tag MG53516-CM
RPS5 cDNA ORF Clone, Mouse, N-Myc tag MG53516-NM

RPS5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS5 cDNA ORF Clone in Cloning Vector, Human HG16364-G
RPS5 cDNA ORF Clone, Human, untagged HG16364-UT
RPS5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16364-ACGLN
RPS5 cDNA ORF Clone, Human, C-GFPSpark® tag HG16364-ACG
RPS5 cDNA ORF Clone, Human, N-GFPSpark® tag HG16364-ANG
RPS5 cDNA ORF Clone, Human, C-OFPSpark® tag HG16364-ACR
RPS5 cDNA ORF Clone, Human, N-OFPSpark® tag HG16364-ANR
RPS5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16364-CF
RPS5 cDNA ORF Clone, Human, C-His tag HG16364-CH
RPS5 cDNA ORF Clone, Human, N-His tag HG16364-NH
RPS5 cDNA ORF Clone, Human, C-HA tag HG16364-CY
RPS5 cDNA ORF Clone, Human, N-HA tag HG16364-NY
RPS5 cDNA ORF Clone, Human, C-Myc tag HG16364-CM
RPS5 cDNA ORF Clone, Human, N-Myc tag HG16364-NM
RPS5 qPCR Primer Pairs, Human HP105115
info info
添加购物车成功! 添加购物车失败!