RPS3A cDNA ORF Clone, Human, C-HA tag

Cat: HG16468-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All RPS3A Reagents
CRO Services
Product recommended

All RPS3A Reagents
RPS3A cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Human ribosomal protein S3A with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RPS3A cDNA ORF Clone, Human, C-HA tag Alternative Names
FTE1 cDNA ORF Clone, Human;MFTL cDNA ORF Clone, Human;S3A cDNA ORF Clone, Human
RPS3A Background Information
Full Name
ribosomal protein S3A

RPS3A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RPS3A cDNA ORF Clone in Cloning Vector, Rat RG81289-U
RPS3A cDNA ORF Clone, Rat, untagged RG81289-UT
RPS3A cDNA ORF Clone, Rat, C-GFPSpark® tag RG81289-ACG
RPS3A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81289-ACGLN
RPS3A cDNA ORF Clone, Rat, N-GFPSpark® tag RG81289-ANG
RPS3A cDNA ORF Clone, Rat, C-OFPSpark® tag RG81289-ACR
RPS3A cDNA ORF Clone, Rat, N-OFPSpark® tag RG81289-ANR
RPS3A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81289-CF
RPS3A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81289-NF
RPS3A cDNA ORF Clone, Rat, C-His tag RG81289-CH
RPS3A cDNA ORF Clone, Rat, N-His tag RG81289-NH
RPS3A cDNA ORF Clone, Rat, C-HA tag RG81289-CY
RPS3A cDNA ORF Clone, Rat, N-HA tag RG81289-NY
RPS3A cDNA ORF Clone, Rat, C-Myc tag RG81289-CM
RPS3A cDNA ORF Clone, Rat, N-Myc tag RG81289-NM
RPS3A qPCR Primer Pairs, Rat RP301245

RPS3A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RPS3A cDNA ORF Clone in Cloning Vector, Human HG16468-G
RPS3A cDNA ORF Clone, Human, untagged HG16468-UT
RPS3A cDNA ORF Clone, Human, C-GFPSpark® tag HG16468-ACG
RPS3A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16468-ACGLN
RPS3A cDNA ORF Clone, Human, N-GFPSpark® tag HG16468-ANG
RPS3A cDNA ORF Clone, Human, C-OFPSpark® tag HG16468-ACR
RPS3A cDNA ORF Clone, Human, N-OFPSpark® tag HG16468-ANR
RPS3A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16468-CF
RPS3A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16468-NF
RPS3A cDNA ORF Clone, Human, C-His tag HG16468-CH
RPS3A cDNA ORF Clone, Human, N-His tag HG16468-NH
RPS3A cDNA ORF Clone, Human, N-HA tag HG16468-NY
RPS3A cDNA ORF Clone, Human, C-Myc tag HG16468-CM
RPS3A cDNA ORF Clone, Human, N-Myc tag HG16468-NM
RPS3A qPCR Primer Pairs, Human HP105213
info info
添加购物车成功! 添加购物车失败!